Knock-sideways by inducible ER retrieval enables a unique approach for studying Plasmodium- secreted proteins

Abstract

Malaria parasites uniquely depend on protein secretion for their obligate intracellular lifestyle but approaches for dissecting Plasmodium -secreted protein functions are limited. We report knockER, a unique DiCre-mediated knock-sideways approach to sequester secreted proteins in the ER by inducible fusion with a KDEL ER-retrieval sequence. We show conditional ER sequestration of diverse proteins is not generally toxic, enabling loss-of-function studies. We employed knockER in multiple Plasmodium species to interrogate the trafficking, topology, and function of an assortment of proteins that traverse the secretory pathway to diverse compartments including the apicoplast (ClpB1), rhoptries (RON6), dense granules, and parasitophorous vacuole (EXP2, PTEX150, HSP101). Taking advantage of the unique ability to redistribute secreted proteins from their terminal destination to the ER, we reveal that vacuolar levels of the PTEX translocon component HSP101 but not PTEX150 are maintained in excess of what is required to sustain effector protein export into the erythrocyte. Intriguingly, vacuole depletion of HSP101 hypersensitized parasites to a destabilization tag that inhibits HSP101-PTEX complex formation but not to translational knockdown of the entire HSP101 pool, illustrating how redistribution of a target protein by knockER can be used to query function in a compartment-specific manner. Collectively, our results establish knockER as a unique tool for dissecting secreted protein function with subcompartmental resolution that should be widely amenable to genetically tractable eukaryotes.

PEXEL is a proteolytic maturation site for both exported and non-exported Plasmodium proteins

“…C-terminally located PEXEL sequences can also be found in Plasmodium proteins but are not known to be processed. For instance, ClpB1, a nuclear-encoded HSP100 that is targeted to the apicoplast, contains an identical PEXEL to PfUIS2 (RILDE) located at positions 1,044–1,048 of 1,070; however, this does not appear to be appreciably processed as C-terminal epitope tags are retained on the full length protein, even when it is artificially retrieved to the ER ( 57 ).…”

“…P. falciparum NF54 attB-DiCre ( 57 ) and derivatives were cultured in RPMI 1640 medium supplemented with 27 mM sodium bicarbonate, 11 mM glucose, 0.37 mM hypoxanthine, 10 µg/mL gentamicin, and 0.5% Albumax I (Gibco). Parasites were maintained in deidentified, Institutional Review Board-exempt RBCs obtained from the American National Red Cross.…”

“…To target the 3′ end of uis2 , a Cpf1 gRNA target was chosen just downstream of the stop codon ( TATTACCTTGATATTCTATTAAGG ), and the gRNA seed sequence was synthesized in primer P2 and inserted at HindIII/AflII in JRB489, resulting in plasmid JRB484. To generate UIS2-mNG parasites, a 5′ homology flank (up to but not including the stop codon) and 3′ homology flank (beginning immediately downstream of the Cpf1 gRNA PAM) were amplified from genomic DNA using P3/4 and P5/6, respectively, assembled in a second PCR reaction using P4/5 and inserted between XhoI/AvrII in JRB508 ( 57 ), resulting in plasmid JRB509. This plasmid was linearized with AflII and co-transfected with JRB484 into NF54 attB-DiCre .…”

“…To generate the UIS2 1-70 -mNG fusion cassette, the 5′ cds of uis2 encoding the first 70 amino acids was amplified from gDNA using P7/8 and inserted at AvrII in JRB416 ( 57 ) removing the adjacent loxP site and inserting an NheI site between the uis2 and mNG sequences, resulting in plasmid JRB510. An R43A PEXEL mutation in UIS2 1-70 -mNG was generated in this plasmid using a QuikChange Lightning Multi Site Directed Mutagenesis kit (Agilent) and the primer P9, resulting in plasmid JRB525.…”

“…Protease protection assays were adapted from reference ( 57 ). Briefly, late-stage parasites were magnet purified and washed with 1× phosphate-buffered saline (PBS).…”