KLF15 Loss-of-Function Mutation Underlying Atrial Fibrillation as well as Ventricular Arrhythmias and Cardiomyopathy

Abstract

Atrial fibrillation (AF) represents the most common type of clinical cardiac arrhythmia and substantially increases the risks of cerebral stroke, heart failure and death. Accumulating evidence has convincingly demonstrated the strong genetic basis of AF, and an increasing number of pathogenic variations in over 50 genes have been causally linked to AF. Nevertheless, AF is of pronounced genetic heterogeneity, and the genetic determinants underpinning AF in most patients remain obscure. In the current investigation, a Chinese pedigree with AF as well as ventricular arrhythmias and hypertrophic cardiomyopathy was recruited. Whole exome sequencing and bioinformatic analysis of the available family members were conducted, and a novel heterozygous variation in the KLF15 gene (encoding Krüppel-like factor 15, a transcription factor critical for cardiac electrophysiology and structural remodeling), NM_014079.4: c.685A>T; p.(Lys229*), was identified. The variation was verified by Sanger sequencing and segregated with autosomal dominant AF in the family with complete penetrance. The variation was absent from 300 unrelated healthy subjects used as controls. In functional assays using a dual-luciferase assay system, mutant KLF15 showed neither transcriptional activation of the KChIP2 promoter nor transcriptional inhibition of the CTGF promoter, alone or in the presence of TGFB1, a key player in the pathogenesis of arrhythmias and cardiomyopathies. The findings indicate KLF15 as a new causative gene responsible for AF as well as ventricular arrhythmias and hypertrophic cardiomyopathy, and they provide novel insight into the molecular mechanisms underlying cardiac arrhythmias and hypertrophic cardiomyopathy.

PRRX1 Loss‐of‐Function Mutations Underlying Familial Atrial Fibrillation

“…Extraction of total RNA from human heart tissue specimens and generation of cDNA were conducted as described previously. 59 An 860‐bp fragment from nucleotide 1 to 860 of the human paired related homeobox 1 ( PRRX1 ) gene (GenBank accession No. NM_006902.4) containing the full‐length open reading frame of PRRX1 was amplified from cDNA by PCR using the PfuUltra High‐Fidelity DNA Polymerase (Stratagene, Santa Clara, CA) and a specific pair of primers (forward primer: 5ʹ‐GCGGAATTCTGATTCGAGCGGGAAGAGGG‐3ʹ; reverse primer: 5ʹ ‐CGCCTCGAGTCCTCAGTTGACTGTTGGCA‐3ʹ).…”

“… 38 To date, via genome‐wide linkage analysis and association study, >160 chromosomal loci have been linked causally to AF, although for the vast majority of these genetic loci, the biological implications remain unclear. 21 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 , 57 , 58 , 59 , 60 , 61 , 62 Moreover, in addition to chromosomal abnormalities (duplications/deletions), pathogenic mutations in >50 genes have been implicated with AF, of which most encode ion channels, gap junction channels, transcriptional factors, sarcomere proteins, and signaling molecules. 21 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 , 57 , 58 , 59 , 60 , 61 , 62 ...…”

“…21 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 , 57 , 58 , 59 , 60 , 61 , 62 Moreover, in addition to chromosomal abnormalities (duplications/deletions), pathogenic mutations in >50 genes have been implicated with AF, of which most encode ion channels, gap junction channels, transcriptional factors, sarcomere proteins, and signaling molecules. 21 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 , 57 , 58 , 59 , 60 , 61 , 62 Of note, loss‐of‐function mutations in TTN and MYL4 also cause AF. 42 , 63 Nevertheless, these already well‐established ge...…”

“… 42 , 63 Nevertheless, these already well‐established genetic defects only account for a minority of AF, because of pronounced genetic heterogeneity of AF. 21 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 , 57 , 58 , 59 , 60 , 61 , 62 , 63 Therefore, further research studies are warranted to better understand the complex genetic basis of AF.…”

A novel PRRX1 loss-of-function variation contributing to familial atrial fibrillation and congenital patent ductus arteriosus

“…Functional analysis of the S140G-mutant KCNQ1 unveiled a gain-of-function impact on the currents of KCNQ1 /KCNE1 and KCNQ1 /KCNE2 channels, which significantly shorten the action potential duration of atrial myocytes thereby increasing the vulnerability to AF ( Chen et al , 2003 ). Up to now, in addition to the association of ~140 genetic loci with increased predisposition to AF revealed by genome-wide association studies ( Kim et al , 2021 ), rare variations in over 50 distinct genes have been discovered to contribute to AF, amidst which the majority encode cardiac potassium ion channels, sodium channels, gap junction channels, calcium channels, signaling molecules, structural proteins and transcription factors ( Choi et al , 2020 ; Ghazizadeh et al , 2020 ; Hansen et al , 2020 ; Huang et al , 2020 ; Jiang et al , 2020 ; Ragab et al , 2020 ; Roselli et al , 2020 ; van Ouwerkerk et al , 2020 ; Wu et al , 2020 ; Yang et al , 2020 ; Chalazan et al , 2021 ; Lazarte et al , 2021 ; Li et al , 2021a , b ; Ziki et al , 2021 ). Interestingly, multiple variations in or near the PRRX1 gene, has recently been associated with an enhanced susceptibility to AF in humans ( Tucker et al , 2017 ; Guo et al , 2021 ; Wu et al , 2021 ).…”