Kinetics of Gene Induction After FcεRI Ligation of Atopic Monocytes Identified by Suppression Subtractive Hybridization

Abstract

The high-affinity receptor for IgE, FcεRI, on APCs plays an important role in the initiation and chronicity of inflammatory atopic diseases. To understand the molecular regulation of FcεRI-mediated processes, differentially expressed genes are of great interest to be identified. Suppression subtractive cDNA hybridization has been used to identify genes induced after FcεRI stimulation on atopic monocytes. Overexpression of the identified genes was determined by semiquantitative RT-PCR analysis of transcripts from the tester (stimulated) and driver (unstimulated) monocytes. Results were confirmed and kinetics of the transcripts established using blood cells from additional atopics at 4 and 24 h of FcεRI induction. The following sequences were identified: monocyte chemoattractant protein 1, macrophage-inflammatory protein 1β, IL-6, βA subunit of inhibin/activin, IFN-stimulated gene of 54 kDa, IL-1R antagonist, and kynurenine 3-monooxygenase. Chemokines are highly expressed during the early and late phase after FcεRI cross-linking, whereas proinflammatory and differentiation stimuli rapidly decline after an initial overexpression. Kynurenine 3-monooxygenase, an enzyme involved in the degradation of the amino acid tryptophan, is significantly up-regulated during the late phase after 24 h of FcεRI induction. These results demonstrate that the analysis of the profile of gene induction following activation of FcεRI on atopic monocytes may reveal how these cells might participate in the regulation of atopic disorders.

FcεRI stimulation promotes the differentiation of histamine receptor 1‐expressing inflammatory macrophages

“…FceRI stimulation and efficient allergen uptake and presentation to T cells are central mechanisms of allergic diseases. Stimulation of FceRI on monocytes promotes NF-jB signalling (28), prevents Fas/Fas-L-mediated apoptosis (29), induces the production of IL-10 (23), upregulates the expression of indoleamine dioxygenase (IDO) and favours the release of proinflammatory mediators such as IL-6, monocytes chemoattractant protein (MCP)-1 or macrophage inflammatory protein (MIP)-1b (30). In addition, FceRI stimulation and consequent IL-10 secretion profoundly promote the differentiation of MФ, while preventing the differentiation of CD1a pos DCs (23).…”

Angiotensin II Participates in Hepatic Inflammation and Fibrosis through MCP-1 Expression

“…Then single-stranded complementary DNA (cDNA) was synthesized from 1 µg of RNA using 0.5 nmol of each random primer and subjected to PCR. Subsequently, the synthesized cDNA was amplified using specific sets of primers for mouse MCP-1 (forward, ATGCAGGTCCCTGTCATG; reverse, GCTTGAGGTGGTTGTGGA) (21), mouse GAPDH (forward, TGAAGGTCGGTGTGAACGGATTTGGC; reverse, CATGTAGGCCATGAGGTCCACC AC) (21), human MCP-1 (forward, GACCACCTGGACAAGCAAAC; reverse, CTCAAAACATCCCAGGGGTA) (22), human RhoA (forward, CTGGTGATTGTTGGTGATGG; reverse, GCGAT-CATAATCTTCCTGCC) (23), and human β-actin (forward, GAGCGGGAAATCGTGCGTGACATT; reverse, GATG-GAGTTGAAGGTAGTTTCGTG) (22). The PCR procedure used has been described previously (21)(22)(23).…”

Immunoglobulin e-bearing antigen-presenting cells in atopic dermatitis

“…DC generated from monocyte precursors in a reducing milieu resemble IDEC in their immunophenotype and produce IL-1α, IL-1β, MCP-1, MCP-3, released on activation, normal T-cell expressed and secreted (RANTES), TNF-α, and MIP-1α on FcεRI crosslinking [34]. Using subtractive hybridization, it could be shown that monocytes from atopic donors can produce transcripts for some of the above-mentioned factors as well as MIP-1β, IL-6, IL-1R antagonist, and kynurenine 3-monooxygenase [40]. LClike DC produce IL-16 upon FcεRI ligation, which serves as a chemoattractant for other DC [41•].…”