Isolation of Vagococcus salmoninarum in Rainbow Trout, Oncorhynchus mykiss (Walbaum), Broodstocks: Characterization of the Pathogen

Abstract

Coldwater 'streptococcosis', caused by Vagococcus salmoninarum, is an emerging disease of rainbow trout in the European Union, causing mortality rates up to 50% in broodstock during the spawning period, with water temperature of 10-12 degrees C. A study to determine the presence and role of this bacterium was undertaken using classical bacteriological techniques confirmed with polymerase chain reaction. This is the first report of isolation of V salmoninarum in relation to outbreaks of mortality in a rainbow trout farm devoted exclusively to broodstock rearing in Spain. A total of 10 isolates of V salmoninarum were characterized by their morphological, cultural, physiological, biochemical and enzymatic traits. Some differences were observed in parameters such as growth on MacConkey agar, H2S production, acid production from starch, and some other minor variations. Isolates were sensitive to erythromycin and oxytetracycline tested in vitro, but treatments conducted in the field were ineffective. An attempt at vaccination did not provide encouraging results.

Identification and typing of Vagococcus salmoninarum using genomic and proteomic techniques

“…Absence of growth on basal medium supplemented with 6.5% of NaCl or adjusted to pH 9.6 and the negative results of arginine hydrolysis and Voges–Proskauer tests allowed for the differentiation of the V. salmoninarum isolates from Streptococcus and Lactococcus genus. The taxonomic position of all strains tested was also confirmed by specific PCR with primers pSal‐1 and pSal‐2 (Ruiz‐Zarzuela et al, ), since amplification of the DNA from all strains produced an amplicon of the expected size (300‐bp).…”

“…Stock bacterial cultures were frozen at −80°C in Microbank TM commercial medium (Pro‐Lab Diagnostics, Ontario, Canada) until use. The taxonomic status of all bacterial isolates was confirmed by specific PCR (Ruiz‐Zarzuela et al, ) using the primers pSal‐1 (5´‐GTTTTAGCCGCATGGCTGAGATAT‐3´) and pSal‐2 (5´‐AGGTGGGAACAGTTACTCTCCCA‐3´) that amplified a fragment of 300 bp of the 16S rRNA gene of V. salmoninarum .…”

“…In the last years, most studies have focused on the study of causative agents of warm‐water streptococcosis because they can be potentially zoonotic agents capable of causing disease in humans (Agnew & Barnes, ; Delannoy et al, ; Wang et al, ; Zaman et al, ). Nevertheless, little is known about cold‐water “streptococcosis” caused by V. salmoninarum (also known as vagococcosis) even though it is considered an emerging disease of rainbow trout ( Oncorhynchus mykiss , Walbaum 1792) in the European Union (Michel, Nougayrède, Eldar, Sochon, & Kinkelin, ; Ozcan, Ispır, & Yılmaz, ; Ruiz‐Zarzuela et al, ; Salogni, Perantoni, Pitozzi, & Alborali, ; Schmidtke & Carson, ; Yardimci et al, ). V. salmoninarum has been isolated from diseased subadults or adults of rainbow trout in Spain (Ruiz‐Zarzuela et al, ), juvenile and adult rainbow trout in France (Michel et al, ), and rainbow trout broodstock and those over 50 g in Italy (Ghittino et al, ; Salogni et al, ) and Turkey (Didinen et al, ; Tanrikul, Avsever, Onuk, & Didinen, ).…”

“…It has been also isolated from rainbow trout, brown trout ( Salmo trutta , Linneo 1978) and Atlantic salmon ( Salmo salar , Linneo 1758) in Australia and Norway (Schmidtke & Carson, ). Streptococcosis caused by this bacterium has a typically chronic course, with mortality rates up to 50%, and affects either subadult or adult fish (>150–200 g; Austin & Austin, ; Didinen et al, ; Michel et al, ; Ruiz‐Zarzuela et al, ). Since diseased fish with streptococcosis show similar clinical signs (external and internal haemorrhages, exophthalmia, accumulation of ascitic fluid in the body cavity, paleness and enlargement of internal organs, etc), definitive identification of the aetiological agent is usually based on the microbiological analysis of affected fish.…”

Identification, technological and safety characterization of Lactobacillus sakei and Lactobacillus curvatus isolated from Argentinean anchovies (Engraulis anchoita)

“…Universal primers PLB and MLB (Kullen et al 2000), Bact 8 F (Edwards et al 1989) and 1391R (Lane et al 1985) were used to partially amplify the 16S rDNA gene by PCR (Table 1). Amplification products, purified from agarose gels with silica beads (Sambrook et al 1989), were sequenced at Cornell University Life Sciences Laboratories Center (Cornell University, USA). The 16S rDNA sequences similarity was compared with the GenBank data library using the nucleotide BLAST program (http://www.ncbi.nlm.nih.gov).…”