Isolation of bacterial probiotic candidates from the gastrointestinal tract of rainbow trout, <i><scp>O</scp>ncorhynchus mykiss</i> (<scp>W</scp>albaum), and screening for inhibitory activity against <i><scp>F</scp>lavobacterium psychrophilum</i>

Burbank, David R.; LaPatra, S. E.; Fornshell, Gary; Cain, Kenneth D.

doi:10.1111/j.1365-2761.2012.01432.x

Cited by 38 publications

(30 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, tolerance to the bile juice represented by the gut isolates in the present study was relatively high. Similar observations were recorded by several authors to establish bile tolerance of the putative probiotic bacteria against fi sh bile (Nikoskelainen et al 2001, Burbank et al 2012, Mukherjee and Ghosh 2014 or commercial bile salts (Allameh et al 2014, Geraylou et al 2014). Finally, bio-safety towards the host is an indispensable criterion for any of the probiotic bacteria under critical evaluation (Verschuere et al 2000).…”

Section: Discussionsupporting

confidence: 67%

Selection and probiotic characterization of exoenzyme-producing bacteria isolated from the gut of Catla catla (Actinopterygii: Cypriniformes: Cyprinidae)

Dutta¹

2015

Acta Ichthyol. Piscat.

View full text Add to dashboard Cite

. 2015. Selection and probiotic characterization of exoenzyme-producing bacteria isolated from the gut of Catla catla (Actinopterygii: Cypriniformes: Cyprinidae). Acta Ichthyol. Piscat. 45 (4): 373-384.Background. Exoenzyme-producing gut microbiota and their likely use as probionts have been widely investigated in major carps. However, reports on exoenzyme-producing capacity together with inhibition of fi sh pathogens are scarce. The presently reported study aimed at characterization of novel probionts from the gastro-intestinal (GI) tract of an Indian major carp-catla, Catla catla (Hamilton, 1822) depending upon extracellular enzyme-production, antagonism against Aeromonas spp., growth in fi sh mucus, bile tolerance, and bio-safety to the target fi sh. Materials and methods. GI tracts were divided into proximal and distal parts, homogenized, and plated onto selective media plates following enrichment culture technique. Exoenzyme-producing isolates were selected through qualitative and quantitative assay of 6 enzymes. Inhibition of Aeromonas spp. was tested through 'cross-streaking' and 'double-layer' method. Tolerance to GI condition was determined by growth in sterilized fi sh mucus and exposure to bile juice. Bio-safety evaluation was done by intra-peritoneal injection of live candidate probiotics and co-culture with autochthonous gut bacteria. Further, 16S rDNA fragments from the putative probiotics were sequenced, edited, analysed, identifi ed, and deposited to the GenBank. Results. Seventeen potent isolates were primarily selected through the ability of producing extracellular enzymes, viz., amylase, protease, lipase, cellulase, phytase, and xylanase. Further study portraying antagonism against Aeromonas salmonicida, A. hydrophila, and A. veronii led to select the strains CCH1A and CCH1Ph as putative probiotics. Both the strains were competent to grow in intestinal mucus and could resist diluted bile juice (9% and 10.5%, respectively). The isolates did not produce any disease symptom or mortality in Catla catla fi ngerlings during the 21 day trial and were competent to grow with other autochthonous isolates. On the basis of phenotypic characteristics and 16S rDNA sequence analysis, the strains CCH1A and CCHIPh were identifi ed as Bacillus aerius (KF623288) and Bacillus sonorensis (KF623289), respectively. Conclusion. Exoenzyme-producing gut bacteria may inhibit the growth of pathogenic Aeromonas spp. and tolerate gastrointestinal condition. Further research is inevitable to explore their potentialities in aquaculture.

show abstract

Section: Discussionsupporting

confidence: 67%

Selection and probiotic characterization of exoenzyme-producing bacteria isolated from the gut of Catla catla (Actinopterygii: Cypriniformes: Cyprinidae)

Dutta¹

2015

Acta Ichthyol. Piscat.

View full text Add to dashboard Cite

show abstract

“…In brief, bacteria were isolated from the GIT of healthy individuals of wild (North Atlantic) and farmed turbot (Stolt Sea Farm AS, Øyestranda, Norway). Bacterial isolates were identified by sequencing the partial 16S rRNA gene using universal eubacteria primers EUB 1F: 5’ AATTGAAGAGTTTGATCATGGCTCA 3’ and EUB 907R: 5’ CCGTCAATTCCTTTRAGTTT 3’ (Burbank, LaPatra, Fornshell, & Cain, ) and BLAST analysis.…”

Section: Methodsmentioning

confidence: 99%

Administration of host‐derived probiotics does not affect utilization of soybean meal enriched diets in juvenile turbot (Scophthalmus maximus)

et al. 2019

View full text Add to dashboard Cite

In today's aquaculture, the cost‐intensive and scarce fishmeal is increasingly replaced by plant‐based feedstuff such as soybean meal (SBM). However, SBM contains saponins which can have adverse effects on fish's digestive tract potentially culminating in severe enteritis. In a 60 day feeding trial we studied the use of autochthonous bacteria as probiotics upon SBM supplementation on juvenile turbot. Growth performance, feed conversion, body composition and health status were assessed for five different treatment groups, comprising a fishmeal control (FM ctrl), a SBM control without probiotics (SBM ctrl) and three multi‐species probiotic treatments. For the production of the probiotic treatments a basal diet with a composition identical to the SBM ctrl including 40% SBM of total dry matter likewise was prepared. The basal diet was stepwise top coated with three different probiotic supplementations: (a) three distinct isolates with saponin‐metabolizing ability (SBM + degrad); (b) three distinct isolates inhibitory towards the pathogen, Tenacibaculum maritimum (SBM + anta); and (c) a commercial probiotic application (SBM + com). Individual weight gain was highest in FM ctrl but only SBM + degrad diet showed a significantly lower value (p < 0.05). The feed conversion ratio was lowest in FM ctrl and significantly higher in SBM + degrad (p < 0.01). The protein retention efficiency did only differ significantly between FM ctrl and SBM + degrad (p < 0.05), whereas lipid retention efficiency remained unaffected. Whole body composition and gross energy content were similar in all treatments lacking significant differences. The condition factor was significantly elevated in SBM + degrad compared to FM ctrl (p < 0.05). Hematocrit was highest in FM ctrl and significantly lower in the other treatments (p < 0.01) with SBM + com accounting for the lowest value (p < 0.001). The hepatosomatic index was slightly increased in FM ctrl but no significant difference was detected. Regarding the spleen somatic index SBM + anta treatment revealed the highest and SBM ctrl a significantly lower value (p < 0.05). In conclusion, the growth performance of fish did not benefit from the different probiotic treatments, while body composition and gross energy content remained at an appropriate level. Moreover, the overall health status was on a sufficient level in all treatments which confirms the high dietary tolerability of our putative probiotic isolates by the fish.

show abstract

“…Burbank et al (23) first showed that Enterobacter C6-6 culture or spent medium inhibited growth of F. psychrophilum in a manner consistent with the presence of a soluble inhibitor. Herein we successfully identified a small protein (entericidin B) in the supernatant of Enterobacter C6-6 cultures that is linked to the inhibitory phenotype in vitro.…”

Section: Discussionmentioning

confidence: 99%

“…strain C6-6, was recently isolated from trout intestines and was shown to inhibit F. psychrophilum on agar diffusion plates (23) while reducing mortality during F. psychrophilum challenge studies (24). The agar diffusion data indicated that the cell-free supernatant of this probiotic strain could inhibit F. psychrophilum growth in vitro.…”

mentioning

confidence: 99%

Entericidin Is Required for a Probiotic Treatment (Enterobacter sp. Strain C6-6) To Protect Trout from Cold-Water Disease Challenge

Schubiger

Orfe

Sudheesh

et al. 2015

Appl Environ Microbiol

View full text Add to dashboard Cite

c Flavobacterium psychrophilum causes bacterial cold-water disease in multiple fish species, including salmonids. An autochthonous Enterobacter strain (C6-6) inhibits the in vitro growth of F. psychrophilum, and when ingested as a putative probiotic, it provides protection against injection challenge with F. psychrophilum in rainbow trout. In this study, low-molecular-mass (<3 kDa) fractions from both Enterobacter C6-6 and Escherichia coli K-12 culture supernatants inhibited the growth of F. psychrophilum. The <3-kDa fraction from Enterobacter C6-6 was analyzed by SDS-PAGE, and subsequent tandem mass spectroscopy identified EcnB, which is a small membrane lipoprotein that is a putative pore-forming toxin. Agar plate diffusion assays demonstrated that ecnAB knockout strains of both Enterobacter C6-6 and E. coli K-12 no longer inhibited F. psychrophilum (P < 0.001), while ecnAB-complemented knockout strains recovered the inhibitory phenotype (P < 0.001). In fish experiments, the engineered strains (C6-6 ⌬ecnAB and C6-6 ⌬ecnAB) and the wild-type strain (C6-6) were added to the fish diet every day for 38 days. On day 11, the fish were challenged by injection with a virulent strain of F. psychrophilum (CSF 259-93). Fish that were fed C6-6 had significantly longer survival than fish fed the ecnAB knockout strain (P < 0.0001), while fish fed the complemented knockout strain recovered the probiotic phenotype (P ‫؍‬ 0.61). This entericidin is responsible for the probiotic activity of Enterobacter C6-6, and it may present new opportunities for therapeutic and prophylactic treatments against similarly susceptible pathogens. P robiotics are defined as live or dead microbial feed supplements that provide health benefits to the host animal (1). Probiotic strains of Bifidobacterium, Lactobacillus, and Streptococcus (2) have been used successfully in people and terrestrial animals, including poultry (3) and cattle (4), for the past century. Probiotic supplementation has gained attention from the aquaculture industry during the last 2 decades, especially for shrimp production, where antibiotic treatment has been reduced dramatically in favor of supplementing feed with commercially available probiotics composed of Bacillus subtilis and Vibrio alginolyticus (5, 6). In aquaculture, a probiotic is further defined as a live microbial cell that, when administered via the feed or to the rearing water, benefits the host by improving disease resistance, health and growth performance, feed utilization, stress response, and meat quality (7,8). The mechanism of action of probiotics has been defined vaguely as improving the host's "microbial balance" (9) or the balance of the ambient environment, but molecular mechanisms are rarely investigated further, even though a number of applied studies have demonstrated probiotic efficacy against a variety of Gram-negative and Gram-positive pathogens in fish and shellfish (7).In the case of salmonid species, such as Atlantic salmon (Salmo salar Linnaeus) and rainbow trout (Oncorhynchus ...

show abstract

Isolation of bacterial probiotic candidates from the gastrointestinal tract of rainbow trout, Oncorhynchus mykiss (Walbaum), and screening for inhibitory activity against Flavobacterium psychrophilum

Cited by 38 publications

References 36 publications

Selection and probiotic characterization of exoenzyme-producing bacteria isolated from the gut of Catla catla (Actinopterygii: Cypriniformes: Cyprinidae)

Selection and probiotic characterization of exoenzyme-producing bacteria isolated from the gut of Catla catla (Actinopterygii: Cypriniformes: Cyprinidae)

Administration of host‐derived probiotics does not affect utilization of soybean meal enriched diets in juvenile turbot (Scophthalmus maximus)

Entericidin Is Required for a Probiotic Treatment (Enterobacter sp. Strain C6-6) To Protect Trout from Cold-Water Disease Challenge

Contact Info

Product

Resources

About