Isolation of a ?6-desaturase gene from the cyanobacterium Synechocystis sp. strain PCC 6803 by gain-of-function expression in Anabaena sp.strain PCC 7120

Reddy, Avutu S.; Nuccio, Michael L.; Groß, Lisa; Thomas, Terry L.

doi:10.1007/bf00014936

Cited by 122 publications

(81 citation statements)

References 24 publications

(32 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…PCC 6803 (Reddy et al, 1993). The identity values of PPDES6 to these proteins were low and ranged from 21% to 27% for the sequence between the first and third histidine boxes and from 12% to 23% over the entire length.…”

Section: Isolation Of a Full-length Cdnamentioning

confidence: 98%

See 1 more Smart Citation

Identification of a novel D6‐acyl‐group desaturase by targeted gene disruption in Physcomitrella patens

et al. 1998

View full text Add to dashboard Cite

SummaryThe moss Physcomitrella patens contains high levels of arachidonic acid. For its synthesis from linoleic acid by desaturation and elongation, novel ∆5-and ∆6-desaturases are required. To isolate one of these, PCR-based cloning was used, and resulted in the isolation of a full-length cDNA coding for a putatively new desaturase. The deduced amino acid sequence has three domains: a N-terminal segment of about 100 amino acids, with no similarity to any sequence in the data banks, followed by a cytochrome b 5 -related region and a C-terminal sequence with low similarity (27% identity) to acyl-lipid desaturases. To elucidate the function of this protein, we disrupted its gene by transforming P. patens with the corresponding linear genomic sequence, into which a positive selection marker had been inserted. The molecular analysis of five transformed lines showed that the selection cartridge had been inserted into the corresponding genomic locus of all five lines. The gene disruption resulted in a dramatic alteration of the fatty acid pattern in the knockout plants. The large increase in linoleic acid and the concomitant disappearance of γ-linolenic and arachidonic acid in all knockout lines suggested that the new cDNA coded for a ∆6-desaturase. This was confirmed by expression of the cDNA in yeast and analysis of the resultant fatty acids by GC-MS. Only the transformed yeast cells were able to introduce a further double bond into the ∆6-position of unsaturated fatty acids. To our knowledge, this is the first report of a successful gene disruption in a multicellular plant resulting in a specific biochemical phenotype.

show abstract

Section: Isolation Of a Full-length Cdnamentioning

confidence: 98%

“…In the last few years, extensive sequence information from various desaturases in the methyl-directed group has been accumulated, but only a few from the carboxyldirected group (Reddy et al, 1993;Sayanova et al, 1997) have been cloned so far. A good source to clone new desaturases is the moss Physcomitrella patens.…”

Section: Introductionmentioning

confidence: 99%

Identification of a novel D6‐acyl‐group desaturase by targeted gene disruption in Physcomitrella patens

et al. 1998

View full text Add to dashboard Cite

show abstract

“…The DNA probe of 1.2 kb for the desA gene was prepared as described previously . The DNA probe for the desD gene was prepared by amplification of a 970 bp fragment of the genomic DNA with the forward primer AAGCTTCACTTCGGTTTTAT and the reverse primer ATACTTCAGGAATGGAAAAGCCC [positions ¹298 to ¹279 and þ 694 to þ 672 respectively (Reddy et al, 1993; EMBL/GenBank/DDJB accession number, L11421)]. The DNA probe for the desB gene was prepared by amplification of an 805 bp fragment of the genomic DNA with the forward primer TTGCAGTCTTAAAGTTTTGACG and the reverse primer TCCGGGACGGAATAGGGGACTGC [positions ¹246 to ¹224 and þ 582 to þ 560 respectively (Sakamoto et al, 1994a; EMBL/GenBank/DDJB accession number, D13780)].…”

Section: Dna Probes and Northern Blotting Analysismentioning

confidence: 99%

Differences in the control of the temperature‐dependent expression of four genes for desaturases in Synechocystis sp. PCC 6803

Los

Ray

Murata

1997

Molecular Microbiology

149

120

View full text Add to dashboard Cite

SummaryCyanobacteria are capable of desaturating the fatty acids in their membrane lipids in response to decreases in temperature. The cyanobacterium, Synechocystis sp. PCC 6803, contains four desaturases, which specifically catalyse desaturation at the ⌬6, ⌬9, ⌬12 and 3 positions of fatty acids. The levels of the mRNAs transcribed from the genes that encode the ⌬6, ⌬12 and 3 desaturases increased about 10-fold, but at different rates, upon a decrease in temperature from 34ЊC to 22ЊC, whereas the level of the mRNA for the ⌬9 desaturase remained constant. The increases in the levels of mRNAs were caused both by the enhanced transcription and by the increased stability of the mRNAs at the low temperature. Western blotting analysis demonstrated that levels of the ⌬6, ⌬12 and 3 desaturases increased at different rates at the low temperature, while that of the ⌬9 desaturase remained constant. These observations indicate that the expression of the genes for the four desaturases is regulated by temperature in different ways.

show abstract

“…PCC 6803 [9][10][11], and Reddy et al [12] isolated the desD gene for A6 acyMipid desaturase from the same cyanobacterium. We compared the amino acid sequences of the four acyl-lipid desaturases and found eight conserved histidine residues (Fig.…”

Section: Introductionmentioning

confidence: 99%

Site‐directed mutagenesis of histidine residues in the Δ12 acyl‐lipid desaturase of Synechocystis

et al. 1995

View full text Add to dashboard Cite

In the cyanobacterium Synechocystis sp. PCC 6803, there are four acyl-lipid desaturases that are, respectively, specific to the A6, A9, A12 and to3 positions of fatty acids. The desA gene for the A12 acyl-lipid desaturase was modified by sitedirected mutagenesis, such that four of the histidine residues that are conserved in the four desaturases and one histidine residue that is not conserved were replaced by arginine, and the mutated desA genes were overexpressed in Escherichia coil All of these mutations eliminated the A12 desaturase activity. These results demonstrate that the five histidine residues are essential for the activity of the A12 desaturase, perhaps by providing the ligands for the catalytic Fe center.

show abstract

Isolation of a ?6-desaturase gene from the cyanobacterium Synechocystis sp. strain PCC 6803 by gain-of-function expression in Anabaena sp.strain PCC 7120

Cited by 122 publications

References 24 publications

Identification of a novel D6‐acyl‐group desaturase by targeted gene disruption in Physcomitrella patens

Identification of a novel D6‐acyl‐group desaturase by targeted gene disruption in Physcomitrella patens

Differences in the control of the temperature‐dependent expression of four genes for desaturases in Synechocystis sp. PCC 6803

Site‐directed mutagenesis of histidine residues in the Δ12 acyl‐lipid desaturase of Synechocystis

Contact Info

Product

Resources

About