Isolation and molecular detection of Streptococcus agalactiae from popped eye disease of cultured Tilapia and Vietnamese koi fishes in Bangladesh

Abstract

Objective Present research aims to isolate, identify, and determine the virulence of the Streptococcus agalactiae (group B Streptococcus ; GBS), isolated from popped eye disease affected Tilapia and Vietnamese Koi (V. Koi) fishes. Materials and Methods A total of 330 fish samples were collected, of which Tilapia ( n = 180) and V. Koi ( n = 150), were collected from 35 affected ponds of four selected districts of Bangladesh. Isolation of the bacterium was done using different culture media (Nutrient broth, Plate count agar, Tryptic Soy Agar, and Blood agar), and identification by using various biochemical tests (conventional and using API 20 Strep kit) and polymerase chain reaction (PCR) using primers against 16S rRNA gene of S. agalactiae . Antibiotic susceptibility of the bacteria was performed using seven different antibiotics disc (Tetracycline, Oxytetracycline, Chlortetracycline, Streptomycin, Ciprofloxacin, Gentamicin, and Neomycin). Virulence of the isolated S. agalactiae was determined by infecting healthy Tilapia and V. Koi fishes through experimental infection. Results Isolated bacteria were found Gram-positive paired and chained cocci, β-hemolytic and non-motile. Findings of biochemical and serological tests indicate that the isolated bacterium belongs to Group B Streptococcus of Lancefield classification. PCR result also confirmed that the bacteria were S. agalactiae . The bacterial isolates possessed resistance property against all the seven antibiotics used in this study. The isolated GBS was found highly virulent and showed 80%–90% mortality for Tilapia and V. Koi fishes in experimental infection within 1–6 days of post-infection. Conclusion From the findings of this study, it may be concluded that isolated GBS from the Tilapia and V. Koi fishes were highly virulent and possessed multidrug-resistance properties.

Intestine and spleen microbiota composition in healthy and diseased tilapia

“…Streptococcus was detected mainly in the spleens of diseased fish with nearly 5.0% mean relative abundance (Table 2 ). Streptococcosis is one of the most severe bacterial infections in aquacultures worldwide and causes enormous economic losses [ 47 , 48 ].…”

Detection of Aeromonas hydrophila possessing aerolysin gene using gold nanoparticle probe

“…These samples were then streaked onto sterile nutrient agar and incubated at 37°C for 24 h. After incubation, isolated colonies were selected and subjected to three successive sub-culturing steps to ensure the purity of the bacterial isolates. The colonies obtained from purified bacterial samples were utilized for DNA extraction through the boil method [19] .…”

Expression of immuno‐transcriptome response in red hybrid tilapia (Oreochromis sp.) hindgut following vaccination with feed‐based bivalent vaccine

“…Bhd., Malaysia), 1.25 μL of 10 μM forward primer, 1.25 μL of 10 μM reverse primer, 1 μL of 100 ng of extracted DNA and 9 μL of nuclease‐free H 2 O. The S. agalactiae was detected by amplification of 16S rRNA at approximately 220 bp using 16S rRNA_F (5′‐GAGTTTGATCATGGCTCAG‐3′) and 16S rRNA_R (5′‐ACCAACATGTGTTAATTACTC‐3′) primer sets (Rahman et al., 2021). Meanwhile, A. hydrophila was detected by amplification of gyrB at approximately 1100 bp using gyrB_F (5′‐TCCGGCGGTCTGCACGGCGT‐3′) and gyrB_R (5′‐TTGTCCGGGTTGTACTCGTC‐3′) primer sets (Yáñez et al., 2003).…”