Isolation and characterization of a suppressor mutation that restores Myxococcus xanthus exopolysaccharide production

Abstract

Myxococcus xanthus, a Gram-negative soil bacterium, undergoes multicellular development when nutrients become limiting. Aggregation, which is part of the developmental process, requires the surface motility of this organism. One component of M. xanthus motility, the social (S) gliding motility, enables the movement of cells in close physical proximity. Previous studies demonstrated that the cell surface-associated exopolysaccharide (EPS) is essential for S motility and that the Dif proteins form a chemotaxis-like pathway that regulates EPS production in M. xanthus. DifA, a homologue of methyl-accepting chemotaxis proteins (MCPs) in the Dif system, is required for EPS production, S motility and development. In this study, a spontaneous extragenic suppressor of a difA deletion was isolated in order to identify additional regulators of EPS production. The suppressor mutation was found to be a single base pair insertion in cheW7 at the che7 chemotaxis gene cluster. Further examination indicated that mutations in cheW7 may lead to the interaction of Mcp7 with DifC (CheW-like) and DifE (CheA-like) to reconstruct a functional pathway to regulate EPS production in the absence of DifA. In addition, the cheW7 mutation was found to partially suppress a pilA mutation in EPS production in a difA + background. Further deletion of difA from the pilA cheW7 double mutant resulted in a triple mutant that produced wildtype levels of EPS, implying that DifA (MCP-like) and Mcp7 compete for interactions with DifC and DifE in the modulation of EPS production.

Type IV Pilus Proteins Form an Integrated Structure Extending from the Cytoplasm to the Outer Membrane

“…These plasmids were constructed using pMY7 which is pZErO (Invitrogen) containing the Aeromonas hydrophila galK gene [30]. Deletion alleles, which were obtained using a two-step PCR procedure as described previously [31], were cloned into pMY7 digested with Bam HI and Eco RI. The Δ pilM allele deleted codons from 8 to 392, Δ pilN from 6 to 222, Δ pilO from 8 to 189 and Δ pilP from 7 to 197 of their respective genes.…”

Gliding Motility Revisited: How Do the Myxobacteria Move without Flagella?

“…xanthus has eight chemosensory systems, although only four have been described in print: Frz, Dif, Che3, Che4, and Che7 (10,148). The Che3 system has been shown to be important for regulating gene expression during the transition between vegetative growth and development and does not appear to play a direct role in the control of motility (64).…”

“…7). For example, a genetic screen showed that the defects in EPS production and development of a difA mutant were suppressed by a mutation in cheW7, which encodes a coupling protein homolog of the che7 gene cluster (10). This suppression required DifC and DifE from the Dif system and Mcp7 from the Che7 system (10).…”

A CRISPR with Roles in Myxococcus xanthus Development and Exopolysaccharide Production

“…CRISPR3 was amplified using CRISPR3_F1 and CRISPR3_R (AGGTCTAGATGGCCTCGCAGCTTCCAGAT). It was digested with HindIII and XbaI and cloned into pWB425 (20) at the same restriction sites to produce pXY105.…”

“…DK10407 (⌬pilA) (18) was mutagenized with the mariner transposon magellan4 (19,20). This transposon contains the E. coli R6K␥ origin of replication and nptII, which confers kanamycin resistance (Kan r ) (19).…”