Isolation and characterization of a virulence related Vibrio alginolyticus strain Wz11 pathogenic to cuttlefish, Sepia pharaonis

Lv, Tengteng; Song, Tongxiang; Liu, Huijie; Peng, Ruibing; Jiang, Xiamin; Zhang, Weiwei; Han, Qingxi

doi:10.1016/j.micpath.2018.10.041

Cited by 19 publications

(12 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…alginolyticus strain Wz11, which had strong hemolytic activity, exhibited high survival rates after a 2 h co-incubation with both liquids of S. pharaonis compared withV. harveyi strain Wz21 and caused higher mortality (Lv et al, 2019). Consistent with the results for V. alginolyticus strain Wz11, the high pathogenicity of strain SDCH87 was subsequently demonstrated according to Koch's Postulates.…”

Section: Discussionsupporting

confidence: 77%

“…Finally, the mucus and liquified tissues of the cuttlefishSepiapharaonis strongly inhibitedV. harveyi strain Wz211 and weakly inhibited V. alginolyticus strain Wz11 after separate co-incubation (Lv et al, 2019).…”

Section: Introductionmentioning

confidence: 94%

“…To investigate bacterial resistance in vitro, mucus was collected following previous studies, with some modifications (Adel et al, 2016;Lv et al, 2019;Valero et al, 2019). Briefly, mucus from the abalone body surface (2.5 ± 0.2 cm in length) was obtained by quickly rinsing the animal with 2 mL filtered seawater (FSW).…”

Section: 3bacterialresistancein Vitromentioning

confidence: 99%

See 2 more Smart Citations

A novel screening method for the detection of Pseudoalteromonas shioyasakiensis, an emerging opportunistic pathogen that caused the mass mortality of juvenile Pacific abalone (Haliotis discus hannai) during a record-breaking heat wave

Li¹,

Wu²,

Wang³

et al. 2020

Preprint

View full text Add to dashboard Cite

A serious disease was recorded in juvenile Pacific abalone in Fujian Province, China in 2018. Although this disease caused no obvious external lesions, affected abalone exhibited bleached pedal epithelial cells and a lack of attachment ability. Bacterial strains were collected and cultured from the mucus of moribund and healthy abalone. A novel method was developed for screening abalone pathogens, based on the important role of mucus in the innate immunity of marine organisms. Using bacterial isolation, sequence analysis, and experimental challenges in vitro and in vivo, we identified the bacterial strains pathogenic to abalone. We verified that abalone mortality rates were high when exposed to Pseudoalteromonas shioyasakiensis strain SDCH87 at high temperatures. This opportunistic pathogen had an outstanding growth ability in mucus, and disrupted first line mucosal immunity in the foot within three days. The unprecedented sea surface temperatures associated with the record-breaking 2018 heatwave in south China may have induced opportunistic pathogenic behavior in P. shioyasakiensis. To our knowledge, this is the first report to show that P. shioyasakiensis is a serious opportunistic pathogen of abalone, or possibly mollusks in general, in the context of a heatwave.

show abstract

Section: Discussionsupporting

confidence: 77%

Section: Introductionmentioning

confidence: 94%

See 1 more Smart Citation

A novel screening method for the detection of Pseudoalteromonas shioyasakiensis, an emerging opportunistic pathogen that caused the mass mortality of juvenile Pacific abalone (Haliotis discus hannai) during a record-breaking heat wave

Li¹,

Wu²,

Wang³

et al. 2020

Preprint

View full text Add to dashboard Cite

show abstract

“…Instead of using the Vibrio pathogens reported in other literature (Mechri et al, 2017; Rameshkumar et al, 2017; Lv et al, 2019) as hosts for lytic phage isolation, our study started with the isolation of Vibrio strains from the diseased shrimp within the shrimp-farmed pond. Furthermore, the pathogenicity of the five Vibrio sp.…”

Section: Discussionmentioning

confidence: 99%

Isolation and Characterization of Specific Phages to Prepare a Cocktail Preventing Vibrio sp. Va-F3 Infections in Shrimp (Litopenaeus vannamei)

et al. 2019

View full text Add to dashboard Cite

Vibrio is one of the most detrimental agents of shrimp premature death syndrome. Phage therapy for prevention and treatment of Vibrio infections has attracted increasing attentions due to the emergence of antibiotic-resistant bacterial variants. Here, we describe a workflow of preparing a phage cocktail against Vibrio infections for practical applications. Twenty Vibrio strains were isolated from the gut of diseased shrimp and aquaculture wastewater, and five of them were identified as pathogens causing shrimp vibriosis. Twenty-two lytic phages were then isolated using the above five pathogens as hosts, and five of them showed broad host ranges and high lytic capability against the Vibrio strains. Whole genomic sequencing and phylogenetic analysis of the five phages indicated that they are novel and belong to the Siphoviridae family. The phage cocktail consisting of these five phages showed higher efficiency in inhibiting the growth of pathogenic Vibrio sp. Va-F3 than any single phage in vitro. We then evaluated the performance of the phage cocktail in protecting shrimp against Vibrio sp. Va-F3 infections in situ. The results showed that shrimp survival rates could reach 91.4 and 91.6% in 7 days, for the cocktail-treated and the antibiotic-treated groups, respectively. By contrast, the shrimp survival rate of the group without any treatment was only 20.0%. Overall, this study describes a general workflow of how to prepare a phage cocktail and apply it in controlling bacterial infections in the shrimp aquaculture. Knowledge gained from this study will not only help fight against the shrimp vibriosis in practical but also facilitate the design of phage cocktails with a satisfying performance in controlling other animal diseases in aquaculture.

show abstract

“…The partial hemolysin gene fragment was PCR-ampli ed using the primer pair tlhF (TCTAGCGAACGAGAACGCAG) and tlhR (ACTGCCCAGTTGTATAGCGG), designed on the basis of Vibrio alginolyticus hemolysin [Lv et al 2019]. The ampli cation products were puri ed and sequenced following the same method as gyrB gene sequencing.…”

Section: Isolation Of Hemolysin Genementioning

confidence: 99%

Isolation and Characterization of a Vibrio Sp. Strain MA3 Possibly Associated with Mass Mortalities of the Pearl Oyster Pinctada fucata

Sakatoku

Hatano

Tanaka

et al. 2021

Preprint

View full text Add to dashboard Cite

In the summers of 2019 and 2020, a previously undescribed disease occurred in both juvenile and adult shellfish, causing mass mortalities in cultured pearl production, characterized by the major symptom of extreme atrophy of the soft tissues, including the mantle. However, the causative organism was uncertain. We isolated Vibrio sp. strain MA3 from the mantles of diseased pearl oysters Pinctada fucata. Analyses of 16S rRNA gene and DNA gyrase sequence homologies and its biochemical and morphological characteristics suggested that strain MA3 is a new strain of Vibrio alginolyticus. In addition, a hemolysin gene (Vhe1) of strain MA3 was detected as one of the virulence factors, and the complete sequence was determined. BLAST searches showed that Vhe1 shares 99.8% nucleotide sequence identity with Vibrio alginolyticus strain A056 lecithin-dependent hemolysin (ldh) gene, complete cds. Experimental infection of healthy oysters via injection with strain MA3 indicated it could cause high mortalities of the typically affected oysters from which the strain was isolated. These results suggest that the newly isolated Vibrio sp. strain MA3 is a putative causal agent of the recent disease outbreaks in Akoya pearl oysters.

show abstract

Isolation and characterization of a virulence related Vibrio alginolyticus strain Wz11 pathogenic to cuttlefish, Sepia pharaonis

Cited by 19 publications

References 44 publications

A novel screening method for the detection of Pseudoalteromonas shioyasakiensis, an emerging opportunistic pathogen that caused the mass mortality of juvenile Pacific abalone (Haliotis discus hannai) during a record-breaking heat wave

A novel screening method for the detection of Pseudoalteromonas shioyasakiensis, an emerging opportunistic pathogen that caused the mass mortality of juvenile Pacific abalone (Haliotis discus hannai) during a record-breaking heat wave

Isolation and Characterization of Specific Phages to Prepare a Cocktail Preventing Vibrio sp. Va-F3 Infections in Shrimp (Litopenaeus vannamei)

Isolation and Characterization of a Vibrio Sp. Strain MA3 Possibly Associated with Mass Mortalities of the Pearl Oyster Pinctada fucata

Contact Info

Product

Resources

About

Isolation and characterization of a virulence related Vibrio alginolyticus strain Wz11 pathogenic to cuttlefish, Sepia pharaonis

Cited by 19 publications

References 44 publications

A novel screening method for the detection of Pseudoalteromonas shioyasakiensis, an emerging opportunistic pathogen that caused the mass mortality of juvenile Pacific abalone (Haliotis discus hannai) during a record-breaking heat wave

A novel screening method for the detection of Pseudoalteromonas shioyasakiensis, an emerging opportunistic pathogen that caused the mass mortality of juvenile Pacific abalone (Haliotis discus hannai) during a record-breaking heat wave

Isolation and Characterization of Specific Phages to Prepare a Cocktail Preventing Vibrio sp. Va-F3 Infections in Shrimp (Litopenaeus vannamei)

​Isolation and Characterization of a Vibrio Sp. Strain MA3 Possibly Associated with Mass Mortalities of the Pearl Oyster Pinctada fucata

Contact Info

Product

Resources

About

Isolation and Characterization of a Vibrio Sp. Strain MA3 Possibly Associated with Mass Mortalities of the Pearl Oyster Pinctada fucata