Iron-Regulated Lysis of Recombinant Escherichia coli in Host Releases Protective Antigen and Confers Biological Containment

Abstract

The use of a recombinant bacterial vector vaccine is an attractive vaccination strategy to induce an immune response to a carried protective antigen. The superiorities of live bacterial vectors include mimicry of a natural infection, intrinsic adjuvant properties, and the potential for administration by mucosal routes. Escherichia coli is a simple and efficient vector system for production of exogenous proteins. In addition, many strains are nonpathogenic and avirulent, making it a good candidate for use in recombinant vaccine design. In this study, we screened 23 different iron-regulated promoters in an E. coli BL21(DE3) vector and found one, P viuB , with characteristics suitable for our use. We fused P viuB with lysis gene E, establishing an in vivo inducible lysis circuit. The resulting in vivo lysis circuit was introduced into a strain also carrying an IPTG (isopropyl-␤-Dthiogalactopyranoside)-inducible P T7 -controlled protein synthesis circuit, forming a novel E. coli-based protein delivery system. The recombinant E. coli produced a large amount of antigen in vitro and could deliver the antigen into zebrafish after vaccination via injection. The strain subsequently lysed in response to the iron-limiting signal in vivo, implementing antigen release and biological containment. The gapA gene, encoding the protective antigen GAPDH (glyceraldehyde-3-phosphate dehydrogenase) from the fish pathogen Aeromonas hydrophila LSA34, was introduced into the E. coli-based protein delivery system, and the resultant recombinant vector vaccine was evaluated in turbot (Scophtalmus maximus). Over 80% of the vaccinated fish survived challenge with A. hydrophila LSA34, suggesting that the E. coli-based antigen delivery system has great potential in bacterial vector vaccine applications.

Development of a Fur-dependent and tightly regulated expression system in Escherichia colifor toxic protein synthesis

“…As described in the previous study [18], 23 promoter candidates were selected from Vibrio parahaemolyticus , Vibrio cholerae , E. coli and Vibrio anguillarum , and their transcription abilities were investigated with pUT t G as screening vector and iron chelator 2,2’-dipyridyl as inducer. Samples were adjusted to OD 600  = 1 to measure the green fluorescence emitted by GFP, so the promoter strength and regulation could be simply correlated with the GFP fluorescence.…”

“…Therefore, as an iron limitation responsive vector, p Y P fhuA1 has great potential in developing ‘suicidal’ containment system for environmentally relevant application. Furthermore, in our previous research, iron-limiting condition was verified as an in vivo stimulating signal, and promoters derived from iron uptake system could be induced in vivo [18]. Therefore, this means P fhuA1 could be used in the construction of in vivo inducible antigen synthesis system, which could alleviate the toxicity or metabolic burden of the host strain and improve the immunogenicity for bacterial vector vaccine [27-32].…”

“…A reporter plasmid pUT t G constructed previously was used as the promoter screening vector [18]. The primers from the former work were applied to amplify the candidate promoters from bacterium chromosomes or plasmids [18].…”

“…The primers from the former work were applied to amplify the candidate promoters from bacterium chromosomes or plasmids [18]. The amplified promoter products, possessing the native start codon, Shine-Dalgarno sequence, and −35 and −10 promoter elements plus additional upstream bases, were inserted into pUT t G, and the resultant plasmids were transformed into E. coli Top10 named Top10/p t P X G ( X mean different promoters) for iron-regulated promoter screening.…”

“…P fhuA1 and P fhuA3 fragments were all amplified from the original P fhuA sequence in the previous work [18], and P fhuA2 (TAATGAAAGTAATTGAGAAAGATTCGCAATTTTTTGCTGATAATGATAATGATAATGATAATGATAATGAAAAATTAATACTAATAAAAACGATTCTCAA) was synthesized by Life Technologies (Shanghai, China). The three promoter fragments fused with their relevant GFPs by overlap polymerase chain reaction (PCR), respectively.…”