IRF3 is an important molecule in the UII/UT system and mediates immune inflammatory injury in acute liver failure

Liu, Liangming; Tu, Wenjuan; Zhu, Tong; Wang, Xiaoting; Tan, Zhi-Li; Zhong, Huan; Gao, De-Yong; Dong, Liang

doi:10.18632/oncotarget.10717

Cited by 13 publications

(16 citation statements)

References 40 publications

(53 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…AMs. IRF3 is also an important transcription factor in cells and serves a role in the post-transcriptional regulation of the proinflammatory cytokines TNF-α and IL-1β (23). In addition, the authors examined the phospho-IRF-3 protein level in nuclear extracts by using western blot analysis to detect the influence of PALM3 on LPS-induced IRF-3 activation.…”

Section: Effect Of Palm3 On the Irf3 Activity In Lps-stimulated Ratmentioning

confidence: 99%

Paralemmin-3 contributes to lipopolysaccharide-induced inflammatory response and is involved in lipopolysaccharide-Toll-like receptor-4 signaling in alveolar macrophages

Chen

Tang

et al. 2017

Int J Mol Med

View full text Add to dashboard Cite

Alveolar macrophages (AMs) are the first line of defense against foreign stimulation in alveoli, and they participate in inflammatory responses during acute lung injury (ALI). Previous studies indicated that paralemmin-3 (PALM3) expression is induced by lipopolysaccharides (LPS) and may be involved in LPS-Toll-like receptor 4 (TLR4) signaling in alveolar epithelial cells. The aim of the present study was to investigate the effect of PALM3 on LPS-induced inflammation and its underlying mechanisms in rat AMs. For this purpose, the authors detected the expression of PALM3 in AMs by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blotting following LPS stimulation. Following this, a recombinant adenovirus expressing short hairpin RNA (shRNA) for PALM3 was constructed, as well as a recombinant adenovirus carrying the rat PALM3 gene to modulate the expression of PALM3 in rat AMs. At 48 h after transfection, the PALM3 expression in AMs was detected by RT-qPCR and western blotting. The levels of several cytokines and the activity of nuclear factor-κB and interferon regulatory factor 3 in AMs were measured after LPS stimulation. The localization of PALM3 and LPS-TLR4 signaling adaptor molecules in AMs was analyzed by confocal microscopy, and the physical interactions of PALM3 with these adaptors were assessed by co-immunoprecipitation assays. LPS induced PALM3 expression in AMs and that PALM3 expression promoted the LPS-induced inflammatory response, while PALM3 downregulation suppressed the LPS-induced inflammatory response in AMs. In addition, the results demonstrated that PALM3 could interact with TLR4, myeloid differentiation factor 88, interleukin (IL)-1 receptor associated kinase-1, tumor necrosis factor receptor associated factor-6, and Toll-IL-1 receptor containing adapter molecule-2 in AMs after LPS stimulation. These results suggested that PALM3 contributes to the LPS-induced inflammatory response and participates in LPS-TLR4 signaling in AMs. These data may provide the basis for the development of novel targeted therapeutic strategies of treating ALI.

show abstract

Section: Effect Of Palm3 On the Irf3 Activity In Lps-stimulated Ratmentioning

confidence: 99%

Paralemmin-3 contributes to lipopolysaccharide-induced inflammatory response and is involved in lipopolysaccharide-Toll-like receptor-4 signaling in alveolar macrophages

Chen

Tang

et al. 2017

Int J Mol Med

View full text Add to dashboard Cite

show abstract

“…The urotensin II (UII)/urotensin receptor (UT) system is composed of UII and its specific receptor G protein-coupled receptor (GPR14) or UT, and is present in the liver ( 9 ), heart ( 10 ), kidney ( 11 ) and other organs. The UII/UT system has a variety of biological effects, such as inducing contraction, expanding blood vessels and influencing metabolism ( 12 ).…”

Section: Introductionmentioning

confidence: 99%

“…Urantide is the most effective UII receptor antagonist as it has fewer side effects and is 50–100 times more potent than other compounds ( 10 , 18 ). Previous studies have shown that urantide could antagonize the expression of UII/UT system components, thereby effectively alleviating ALI and inhibiting the proliferation of Kupffer cells ( 9 , 19 ). However, to the best of our knowledge, there has been no relevant report on whether the antagonistic UII/UT system affects the MAPK signalling pathway in preventing liver injury.…”

Section: Introductionmentioning

confidence: 99%

Urantide prevents CCl4‑induced acute liver injury in rats by regulating the MAPK signalling pathway

Guo

Cui

et al. 2021

Mol Med Rep

View full text Add to dashboard Cite

a number of drugs and other triggers can cause acute liver injury (ali) in clinical practice. Therefore, identifying a safe drug for the prevention of liver injury is important. The aim of the present study was to investigate the potential preventive effect and regulatory mechanism of urantide on carbon tetrachloride (ccl 4 )-induced ali by investigating the expression of components of the MaPK signalling pathway and the urotensin ii (uii)/urotensin receptor (uT) system. liver oedema and severe fatty degeneration of the cytoplasm were observed in ali model rats, and the serum alanine aminotransferase (alT) and aspartate aminotransferase (aST) levels were found to be significantly increased. Compared with those in the ali model group, alT and aST levels and the liver index did not significantly increase in each group given the preventive administration of urantide, and the liver tissue morphology was correspondingly protected. Moreover, the gene and protein expression levels of uii, G protein-coupled receptor (GPr14) and the oxidative stress-sensitive cytokines, α-smooth muscle actin and osteopontin were decreased, indicating that the protein translation process was effectively maintained. However, the expression levels of MaPK signalling pathway-related proteins and genes were decreased. it was found that urantide could effectively block the MaPK signalling pathway by antagonizing the uii/uT system, thus protecting the livers of ali model rats. Therefore, it was suggested that ali may be associated with the MaPK signalling pathway, and effective inhibition of the MaPK signalling pathway may be critical in protecting the liver.

show abstract

“…The reaction consisted of a mixture of 10 µl SYBR-Green, 3 µl cDNA template, 1 µl each of both the forward and reverse primers against IFN-β (forward, CAACTTGCTTGGATTCCTACAAAG and reverse primer, TATTCAAGCCTCCCATTCAATTG); IRF3 (forward, CGGAAAGAAGTGTTGCGGTTAG and reverse primer, TTTGCCATTGGTGTCAGGAGAG); and β-actin (forward, CCTGGCACCCAGCACAAT and reverse primer, GCCGATCCACACGGAGATCT), and 5 µl free deionised diethylpyrocarbonate D.W. to a final volume of 20 µl. The sequences of the primers are based on previous studies (28,29).…”

Section: Methodsmentioning

confidence: 99%

Low type I interferon response in COVID‑19 patients: Interferon response may be a potential treatment for COVID‑19

et al. 2021

View full text Add to dashboard Cite

Interferons (IFN) are antiviral cytokines that mitigate the effects of invading viruses early on during the infection process. SARS-CoV and MERS induce weak IFN responses; hence, the clinical trials which included recombinant IFN accompanied with other antiviral drugs exhibited improved results in terms of shortening the duration of illness. The aim of the present study was to evaluate the type I IFN response in COVID-19 patients to determine whether it is sufficient to eliminate or reduce the severity of the infection, and whether it can be recommended as a potential therapy. Total RNA samples were converted to cDNA and used as templates to evaluate the gene expression levels of IFN regulatory factor (IRF)3 and IFN-β in COVID-19 patients or control. The results showed that IRF3 gene expression was upregulated ~250-fold compared with the negative samples. In contrast, IFN-β expression increased slightly in COVID-19 patients. Consistent with other coronaviruses, such as SARS-CoV and MERS, COVID-19 infection does not induce an efficient IFN response to reduce the severity of the virus. This may be attributed to an incomplete response of IRF3 in activating the IFN-β promoter in the infected patients. The results suggest IFN-β or α may be used as potential treatments.

show abstract

IRF3 is an important molecule in the UII/UT system and mediates immune inflammatory injury in acute liver failure

Cited by 13 publications

References 40 publications

Paralemmin-3 contributes to lipopolysaccharide-induced inflammatory response and is involved in lipopolysaccharide-Toll-like receptor-4 signaling in alveolar macrophages

Paralemmin-3 contributes to lipopolysaccharide-induced inflammatory response and is involved in lipopolysaccharide-Toll-like receptor-4 signaling in alveolar macrophages

Urantide prevents CCl4‑induced acute liver injury in rats by regulating the MAPK signalling pathway

Low type I interferon response in COVID‑19 patients: Interferon response may be a potential treatment for COVID‑19

Contact Info

Product

Resources

About