Iodometric and Molecular Detection of ESBL Production Among Clinical Isolates ofE. coliFingerprinted by ERIC-PCR: The First Egyptian Report Declares the Emergence ofE. coliO25b-ST131clone Harboringbla_GES

Abstract

The extensive use of β-lactam antibiotics has led to emergence and spread of extended-spectrum β-lactamases (ESBLs). This study was conducted to investigate the prevalence of 7 different ESBL genes (bla, bla, bla, bla, bla, bla, and bla) and O25b-ST131 high-risk clone among 61 clinical isolates of Escherichia coli. Also, one broad-spectrum β-lactamase (bla) was investigated. This study was also constructed to evaluate iodometric overlay method in detection of ESBL production. Phenotypic identification of E. coli isolates using API 20E revealed 18 distinct biotypes. DNA fingerprinting using enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR) differentiated all isolates into 2 main phylogenetic groups with 60 distinct genetic profiles. Elevated values of minimal inhibitory concentration (MIC) and MIC for third- and fourth-generation cephalosporins were observed. Phenotypic tests revealed that 85.24% of isolates were ESBL producers. The incidence rates of bla, bla, bla, bla, bla, and bla among E. coli ESBL producer phenotype were 69.23%, 25%, 96.15%, 3.85%, 11.54%, and 48%, respectively. On the other hand, bla and bla were not detected. Sequencing of bla and bla revealed that bla and bla were the most prevalent variants. Group characterization of bla revealed that bla was the most prevalent group of bla family. It was found that 30.77% of E. coli ESBL producers belonged to O25b-ST131 clone harboring bla. This study concluded that iodometric overlay method was 100% sensitive in detection of ESBL production. To our knowledge, this is the first Egyptian study that declares the emergence of E. coli O25b-ST131 harboring bla.

Antibiotic Susceptibility and Molecular Characterization of Escherichia coli O157 Isolates from Urinary Tract Infections

“…ERIC-PCR results can revealed the isolates in the same cluster were highly homogenous and had close genetic relationship [23,24]. Using this approach, our isolates were classified into four clusters at 0.58 similarity (Fig.…”

Prevalence of blaTEM, blaSHV and blaCTX-M among β-lactamase producing Escherichia coli isolated from tertiary care hospitals in Taif, Saudi Arabia

“…Isolate was considered to be ESBL producer when expanded zone of inhibition was observed around either ceftazidime and/or cefotaxime disc from side towards to amoxicillin/clavulanic disc. [25] …”

“…Colony PCR method was employed as previously described by El-Badawy et al in which a colony of bacterial isolate was picked up with a small tip of micropipette and dipped onto the bottom of 0.2 ml PCR tube [25] ; this colony represented the DNA template to which the PCR reaction mix (HOT FIREPol ® Blend Master Mix, Solis BioDyne, Tartu, Estonia) was added. The PCR reaction was done in a final reaction volume of 20µl according to the instructions of the manufacturer.…”

“…The 20µl reaction mixture contained 4µl of 5x master mix, 0.6 µl of forward primer (10pmol/μl), 0.6 µl of reverse primer (10pmol/μl) and 14.8 µl distilled water. [26] SHV F: AAGATCCACTATCGCCAGCAG R: ATTCAGTTCCGTTTCCCAGCGG 231bp [25] CTX-M F: ATGTGCAGYACCAGTAARGT R: TGGGTRAARTARGTSACCAGA 594bp [27] Prevalence of blaTEM, blaSHV and blaCTX-M among β-lactamase producing Escherichia coli …. …”

The Relationship Between Class I and II Integrons and Antibiotic Resistance Among Escherichia coli Isolates From Urinary Tract Infections

“…The development of antibiotic resistance by uropathogenic E. coli (UPEC) has led to severe problems in the treatment of infections. 4,5 The uptake of genetic elements such as plasmids, integrons and transposons by E. coli is a key factor in the dissemination of drug-resistance. 6 Integrons which are transmitted horizontally include several genetic factors which can carry and spread drug resistance among these bacteria.…”