Involvement of PML-I in reformation of PML nuclear bodies in acute promyelocytic leukemia cells by leptomycin B

Wang, Chao; Su, Li De; Shao, Yi; Chen, Wei Zhong; Bu, Na; Hao, Rui; Li, Ya; Hussain, Liaqat; Lu, Xiao Yang; Wang, Qian Qian; Naranmandura, Hua

doi:10.1016/j.taap.2019.114775

Cited by 4 publications

(2 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The unique sequences in the C-terminus of PML I contains a nuclear export signal (NES) that allows PML I to shuttle between the nucleus and cytoplasm [ 50 ]. Interestingly, both the PML I overexpression and inhibition of nuclear export promote the reformation of ND10 in cells derived from acute promyelocytic leukemia [ 51 ], suggesting that a high level of PML I in the nucleus may contribute to the formation of ND10. We demonstrated that in RHG105-infected cells, the lack of secondary degradation of PML I leads to a resurgence of PML I and reformation of ND10-like structures late in HSV-1 infection, while ICP0 has been translocated into the cytoplasm after the DNA replication [ 43 ].…”

Section: Discussionmentioning

confidence: 99%

A Novel Recognition by the E3 Ubiquitin Ligase of HSV-1 ICP0 Enhances the Degradation of PML Isoform I to Prevent ND10 Reformation in Late Infection

Fada

Guha

Zheng

et al. 2023

Viruses

View full text Add to dashboard Cite

Upon viral entry, components of ND10 nuclear bodies converge with incoming DNA to repress viral expression. The infected cell protein 0 (ICP0) of herpes simplex virus 1 (HSV-1) contains a RING-type E3 ubiquitin ligase that targets the ND10 organizer, PML, for proteasomal degradation. Consequently, ND10 components are dispersed and viral genes are activated. Previously, we reported that ICP0 E3 differentiates two similar substrates, PML isoforms I and II, and demonstrated that SUMO-interaction has profound regulatory effects on PML II degradation. In the present study, we investigated elements that regulate the PML I degradation and found that: (i) two regions of ICP0 flanking the RING redundantly facilitate the degradation of PML I; (ii) downstream of the RING, the SUMO-interaction motif located at residues 362–364 (SIM362–364) targets the SUMOylated PML I in the same manner as that of PML II; (iii) upstream of the RING, the N-terminal residues 1–83 mediate PML I degradation regardless of its SUMOylation status or subcellular localization; (iv) the reposition of residues 1–83 to downstream of the RING does not affect its function in PML I degradation; and (v) the deletion of 1–83 allows the resurgence of PML I and reformation of ND10-like structures late in HSV-1 infection. Taken together, we identified a novel substrate recognition specific for PML I, by which ICP0 E3 enforces a continuous PML I degradation throughout the infection to prevent the ND10 reformation.

show abstract

Section: Discussionmentioning

confidence: 99%

A Novel Recognition by the E3 Ubiquitin Ligase of HSV-1 ICP0 Enhances the Degradation of PML Isoform I to Prevent ND10 Reformation in Late Infection

Fada

Guha

Zheng

et al. 2023

Viruses

View full text Add to dashboard Cite

show abstract

“…Region specific primers used for sequencing analysis were shown in Table S6. Details of PML -/-HeLa cells's construction by CRISPR-Cas9 technology were described in our previous article (36). The autophagy deficient p62 -/-HeLa cells were constructed by CRISPR-Cas9 technology as described (37), with GTGACGAGGAATTGACAATG as guide RNA.…”

Section: Rna Extraction Qpcr Analysis Sequencing Analysis and Construction Of Pml -/As Well As P62 -/-Hela Cells By Crispr-cas9mentioning

confidence: 99%

Hyperthermia Selectively Destabilizes Oncogenic Fusion Proteins

Maimaitiyiming

Wang

Yang

et al. 2021

Blood Cancer Discovery

Self Cite

View full text Add to dashboard Cite

PML/RARα fusion protein is the oncogenic driver in acute promyelocytic leukemia (APL). While most APL cases are cured by PML/RARα targeting therapy, relapse and resistance can occur due to drug-resistant mutations. Here we report that thermal stress destabilizes PML/RARα protein, including clinically identified drug-resistant mutants. AML1/ETO and TEL/AML1 oncofusions show similar heat shock susceptibility. Mechanistically, mild hyperthermia stimulates aggregation of PML/RARα in complex with nuclear receptor corepressors leading to ubiquitin mediated degradation via SIAH2 E3 ligase. Hyperthermia and arsenic therapy destabilize P/R via distinct mechanisms and are synergistic in primary patient samples and in vivo including 3 refractory APL cases. Collectively, our results suggest that by taking advantage of a biophysical vulnerability of PML/RARα, thermal therapy may improve prognosis in drug-resistant or otherwise refractory APL. These findings serve as a paradigm for therapeutic targeting of fusion oncoprotein associated cancers by hyperthermia. Statement ofSignificance: Hyperthermia destabilizes oncofusion proteins including PML/RARα and acts synergistically with standard arsenic therapy in relapsed and refractory acute promyelocytic leukemia. The results open up the possibility that heat shock sensitivity may be an easily targetable vulnerability of oncofusion-driven cancers.

show abstract