Involvement of p54(nrb), a PSF partner protein, in DNA double-strand break repair and radioresistance

Li, Shuyi; Kuhne, Wendy; Kulharya, Anita S.; Hudson, Farlyn Z.; Ha, Kyungsoo; Zhi-min, Cao; Dynan, William S.

doi:10.1093/nar/gkp741

Cited by 81 publications

(87 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Since then, diverse studies have described it as a protein with pleiotropic functions mainly involved in RNA processing and transport, as well as a transcription factor (27). It has been implicated in diverse pathways, such as nuclear receptor signaling (35), DNA repair (36,37), and viral infection (38). Here we have shown that it can directly activate the p16-Ink4A locus, an important regulator of the G1 exit checkpoint of the cell cycle.…”

Section: Discussionmentioning

confidence: 69%

NONO couples the circadian clock to the cell cycle

Kowalska

Ripperger

Hoegger

et al. 2012

Proc. Natl. Acad. Sci. U.S.A.

215

210

View full text Add to dashboard Cite

Mammalian circadian clocks restrict cell proliferation to defined time windows, but the mechanism and consequences of this interrelationship are not fully understood. Previously we identified the multifunctional nuclear protein NONO as a partner of circadian PE-RIOD (PER) proteins. Here we show that it also conveys circadian gating to the cell cycle, a connection surprisingly important for wound healing in mice. Specifically, although fibroblasts from NONO-deficient mice showed approximately normal circadian cycles, they displayed elevated cell doubling and lower cellular senescence. At a molecular level, NONO bound to the p16-Ink4A cell cycle checkpoint gene and potentiated its circadian activation in a PER proteindependent fashion. Loss of either NONO or PER abolished this activation and circadian expression of p16-Ink4A and eliminated circadian cell cycle gating. In vivo, lack of NONO resulted in defective wound repair. Because wound healing defects were also seen in multiple circadian clock-deficient mouse lines, our results therefore suggest that coupling of the cell cycle to the circadian clock via NONO may be useful to segregate in temporal fashion cell proliferation from tissue organization.keratinocyte | p54nrb | RNA-binding protein | paraspeckle protein T he circadian clock adapts organisms to their daily surroundings both behaviorally and physiologically. In animals, not only are complex behaviors such as sleep and mood governed by this oscillator, but also different body functions such as digestion, circulation, and respiration (1). The basic mechanism of this clock is cell-autonomous in all studied species possessing a circadian clock. In mammals, individual clocks in most cells are synchronized by a brain "master clock" in the suprachiasmatic nucleus of the hypothalamus to orchestrate all rhythmic physiology (2). On a cellular level, circadian physiology extends even to processes such as proliferation (3-7), apoptosis (8), and DNA damage repair (6, 9), which are thought to play important roles in cancer control (8,10).In individual cells, the circadian clock mechanism consists of oscillating feedback loops of transcription of "core" oscillator genes and posttranslational modifications of their protein products that regulate protein stability, activity, and/or localization. For example, in mammals the transcription of periods (Per) and cryptochomes (Cry) are activated by BMAL1:CLOCK heterodimers at cisacting elements called E-boxes, and their protein products form complexes that repress their own transcription (11). We originally identified the RNA-binding protein NONO (also called p54nrb) biochemically as a new member of this circadian transcriptional repressor complex in mice, and mutation of its ortholog NonA in flies resulted in severe attenuation of circadian rhythmicity (12). However, apart from its interaction with this circadian repressor complex, NONO's mechanism of action within the clock remains unknown.The mechanism of the cell cycle has been reviewed extensively elsewhere (13,14). Rathe...

show abstract

Section: Discussionmentioning

confidence: 69%

NONO couples the circadian clock to the cell cycle

Kowalska

Ripperger

Hoegger

et al. 2012

Proc. Natl. Acad. Sci. U.S.A.

215

210

View full text Add to dashboard Cite

show abstract

“…In the current study we found that overexpression of HLXB9 in mouse insulinoma MIN6 ␤-cells (containing normal endogenous menin), a condition that coincides with apoptosis, showed reduced level of transfected Nono protein. It has been previously noted that Nono is also down-regulated in melanoma cells undergoing apoptosis where Nono acts as a survival factor promoting a response to counteract apoptosis (24,25,43). Therefore, it appears that ectopic Nono expression is not tolerated in cells undergoing HLXB9-induced apoptosis.…”

Section: Discussionmentioning

confidence: 99%

Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b)

Desai¹,

Kharade²,

Parekh³

et al. 2015

Journal of Biological Chemistry

View full text Add to dashboard Cite

Background: Pancreatic-islet ␤-cell tumors (insulinomas) that lack menin express the phospho-isoform of the differentiation factor HLXB9. Results: Phospho-HLXB9 interacts with the survival factor p54nrb/Nono and also activates the oncogenic c-Met pathway by down-regulating the c-Met inhibitor Cblb. Conclusion: Targeting the HLXB9-Nono interaction and c-Met in insulinomas can be therapeutic. Significance: ␤-Cell proliferation mechanisms propose tumor therapy and strategies to alleviate ␤-cell loss in diabetes.

show abstract

“…PCR was performed for 40 cycles in an Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany): 94 for 1 min, 55 for 1 min, and 72 for 1 min. ␤-Actin primers (sense 5=-AGTCCTGTGGCATCCAC-GAAACTA and antisense ACTGTGTTGGCGTACAGGTCTTTG) were used as internal standard (13). The PCR products were analyzed on 1.5% agarose gel and stained with ethidium bromide.…”

Section: Methodsmentioning

confidence: 99%

Activation of G protein-coupled estrogen receptor induces endothelium-independent relaxation of coronary artery smooth muscle

Barman

et al. 2011

American Journal of Physiology-Endocrinology and Metabolism

100

View full text Add to dashboard Cite

Estrogens can either relax or contract arteries via rapid, nongenomic mechanisms involving classic estrogen receptors (ER). In addition to ERα and ERβ, estrogen may also stimulate G protein-coupled estrogen receptor 1 (GPER) in nonvascular tissue; however, a potential role for GPER in coronary arteries is unclear. The purpose of this study was to determine how GPER activity influenced coronary artery reactivity. In vitro isometric force recordings were performed on endothelium-denuded porcine arteries. These studies were augmented by RT-PCR and single-cell patch-clamp experiments. RT-PCR and immunoblot studies confirmed expression of GPER mRNA and protein, respectively, in smooth muscle from either porcine or human coronary arteries. G-1, a selective GPER agonist, produced a concentration-dependent relaxation of endothelium-denuded porcine coronary arteries in vitro. This response was attenuated by G15, a GPER-selective antagonist, or by inhibiting large-conductance calcium-activated potassium (BK(Ca)) channels with iberiotoxin, but not by inhibiting NO signaling. Last, single-channel patch-clamp studies demonstrated that G-1 stimulates BK(Ca) channel activity in intact smooth muscle cells from either porcine or human coronary arteries but had no effect on channels isolated in excised membrane patches. In summary, GPER activation relaxes coronary artery smooth muscle by increasing potassium efflux via BK(Ca) channels and requires an intact cellular signaling mechanism. This novel action of estrogen-like compounds may help clarify some of the controversy surrounding the vascular effects of estrogens.

show abstract

Involvement of p54(nrb), a PSF partner protein, in DNA double-strand break repair and radioresistance

Cited by 81 publications

References 49 publications

NONO couples the circadian clock to the cell cycle

NONO couples the circadian clock to the cell cycle

Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B-lineage Lymphoma b)

Activation of G protein-coupled estrogen receptor induces endothelium-independent relaxation of coronary artery smooth muscle

Contact Info

Product

Resources

About