Involvement of OCTN2 and B^0,+in the transport of carnitine through anin vitromodel of the blood–brain barrier

Abstract

Carnitine is known to accumulate in brain, therefore transport of carnitine through the blood-brain barrier was studied in an in vitro system using bovine brain capillary endothelial cells (BBCEC) grown on filter inserts in a co-culture system with glial cells. Long-term exposure of BBCEC to carnitine resulted in a high accumulation of long-chain acyl carnitines, which decreased dramatically upon removal of carnitine. Kinetic analysis of carnitine accumulation indicated a possibility of functioning of more than one transporter. BBCEC were incubated in the presence of substrates and inhibitors of known carnitine transporters added from either apical or basolateral side. Inhibition by replacement of sodium and expression of OCTN2 (RT-PCR) were in agreement with earlier reports on the functioning of OCTN2 in apical membrane. For the first time, functioning of OCTN2 was demonstrated in the basolateral membrane, as well as functioning in both membranes of a low affinity carnitine transporter B 0,+ . Expression of B 0,+ in BBCEC was confirmed by RT-PCR. These results suggest that OCTN2 and B 0,+ could be involved in carnitine transport in both the apical and basolateral membrane.

Localization of organic cation/carnitine transporter (OCTN2) in cells forming the blood–brain barrier

“…Presence of mRNA coding this high affinity carnitine transporter was shown previously (Kido et al. 2001; Berezowski et al. 2004; Inazu et al.…”

“…2006) and in the brain capillary endothelial cells (Kido et al. 2001; Berezowski et al. 2004) by conventional RT‐PCR method.…”

“…The first reports on the presence of carnitine transporter OCTN2 in the blood–brain barrier came from the group of Kido et al. (2001) and our studies (Berezowski et al. 2004).…”

“…Two genes have been selected for estimation of a relative expression of OCTN2, β‐actin and 18S rRNA, β‐actin specific fragment was detected with oligonucleotides (5′‐GAAGTACCCCATTGAACACG‐3′) and (5′‐GGTCTCAAACATGATCTGGG‐3′) corresponding to nucleotides 201–220 and 359–378, respectively, from the conserved region of rat β‐actin sequence (Accession No. ) (Berezowski et al. 2004).…”

“…2004). Presence of RT‐PCR product corresponding to the fragment of mRNA coding OCTN2 was found in rat and bovine endothelial cells (Berezowski et al. 2004).…”