Involvement of autophagy in trypsinogen activation within the pancreatic acinar cells

Abstract

Autophagy is mostly a nonselective bulk degradation system within cells. Recent reports indicate that autophagy can act both as a protector and killer of the cell depending on the stage of the disease or the surrounding cellular environment (for review see Cuervo, A.M. 2004. Trends Cell Biol. 14:70–77). We found that cytoplasmic vacuoles induced in pancreatic acinar cells by experimental pancreatitis were autophagic in origin, as demonstrated by microtubule-associated protein 1 light chain 3 expression and electron microscopy experiments. To analyze the role of macroautophagy in acute pancreatitis, we produced conditional knockout mice lacking the autophagy-related 5 gene in acinar cells. Acute pancreatitis was not observed, except for very mild edema in a restricted area, in conditional knockout mice. Unexpectedly, trypsinogen activation was greatly reduced in the absence of autophagy. These results suggest that autophagy exerts devastating effects in pancreatic acinar cells by activation of trypsinogen to trypsin in the early stage of acute pancreatitis through delivering trypsinogen to the lysosome.

Relationship of strain-dependent susceptibility to experimentally induced acute pancreatitis with regulation of Prss1 and Spink3 expression

“…25 Northern Blot Analysis Total RNAs were extracted from the pancreas with Sepasol (Nacalai Tesque, Kyoto, Japan). For making digoxigeninlabeled RNA probes (Roche Molecular Biochemicals, Germany), mouse Spink3 and Prss1 probes were derived from mouse pancreas RNA by reverse transcriptase PCR using the following nucleotide sequences: mPsti1 (agttcttctggcttttgcaccc) and mPsti26 (cccacgttgcctttcattacgg); Prss1: mPrss1-s1 (taaaggcaggcttccatccagg) and mPrss1-a1 (tgacagtgactgcagagggatt).…”

“…25 Primary antibodies to the following antigens were used at the indicated dilutions: Spink3 (Transgenic Inc., Kumamoto, Japan), 1:1000; Prss1 (Nordic immunological laboratories, Tilburg, Netherlands), 1:1000; amylase (Santa Cruz Biotechnology, CA, USA), 1:1000; and light chain 3 (LC3) (MBL International, Woburn, MA, USA), 1:1000. An anti-rabbit secondary immunoglobulin G antibody conjugated with horseradish peroxidase (Amersham Biosciences Corp, Piscataway, NJ, USA) was used to detect all proteins.…”

“…23 We earlier showed that Spink3 (mouse homolog of human SPINK1) has dual functions for trypsin inhibition: one as a trypsin inhibitor by direct binding to trypsin 24 and another as a suppressor of autophagy, which is involved in trypsinogen activation. 25,26 In summary, mutations in PRSS1 27 and SPINK1 19 genes are acknowledged as genetic risk factors for pancreatitis in human patients.…”

Basal autophagy maintains pancreatic acinar cell homeostasis and protein synthesis and prevents ER stress

“…Until recently, however, the role of autophagy in pancreatitis has been controversial. On one hand, the genetic inhibition of autophagy [Autophagy Related 5 (Atg5) gene ablation] was found to reduce trypsinogen activation and attenuate pancreatic damage in mice challenged with the pancreatic enzyme secretagogue cerulein (13); but selective and protective autophagy can sequester and degrade potentially deleterious activated zymogens during early pancreatitis (14). More recent findings from experimental models (cerulein-induced pancreatitis), and genetically altered mice (Pdx-Cre; Ikkα F/F , also known as Ikkα Δpan , and Significance This work identifies autophagy as an essential homeostatic process that maintains pancreatic acinar cell function.…”

“…IKKα deficiency impairs the completion of autophagy in acinar cells, with accumulation of the chaperon and autophagy substrate ubiquitin-binding protein p62/SQSTM1 as the key pathogenic mechanism (15). However, ablation of ATG5 was reported to either inhibit (13) or promote (16) pancreatitis. In addition, inhibition of autophagy can either accelerate the development of early malignant lesions in mice lacking the transformation-related protein 53 (p53) (19) or cause the death of established pancreatic cancer (20).…”