Investigation of the Antiviral Effects of Saussurea lappa Root Extract against SARS‐CoV‐2 Virus

Abstract

Scope The purpose of this study was to look into the antiviral activity of a plant extract derived from the roots of the Saussurea lappa as a food supplement against SARS‐CoV‐2 infection. Methods and results Vero E6 cells are employed in the study to test the neutralizing effect of Saussurea lappa extract against the SARS‐CoV‐2 virus. For anti‐viral activity detection, a sensitive real‐time cell analyzer (xCELLigence RTCA) with a high repetition rate is used. A challenge experiment in mice is planned as a result of the in vitro analysis. A challenge test against SARS‐CoV‐2 is performed with 10 adult female K18‐hACE2 transgenic mice in each group for this purpose. The mice in the S. lappa Group are gavaged 2 days before the virus is administered intranasally (i.n.). The control group received PBS instead of the extract. SARS‐CoV‐2 virus is administered i.n. under anesthesia for the first 3 days of the experiment, and S. lappa extract was administered by gavage in the afternoon. On the 10th day, mice in the S. lappa group survived the study, whereas animals in the control group grew ill and/or died. In this study, the extract protects the mice against the SARS‐CoV‐2 virus in 90% of the cases. Conclusions This study demonstrates that the Saussurea plant has antiviral effects against SARS‐CoV‐2 in vitro and in animal models.

Immunogenicity and protection efficacy of a COVID-19 DNA vaccine encoding spike protein with D614G mutation and optimization of large-scale DNA vaccine production

“…Accordingly, healthy lungs without lesions were scored 0, lungs with edema and hyperemia were scored between 0.5 and 1, different rates of pneumonia lesions were scored between 1.5 and 5, and dead mice were scored 5. Lungs were also collected for histopathological examination and determination of virus load by RT-qPCR as previously described 33 , 34 .…”

“…Viral RNA detection was performed using One Step PrimeScript III RT‐qPCR Kit (Takara, Japan) according to the manufacturer’s protocol. The RT-qPCR targeting nucleocapsid (NC) gene of SARS‐CoV‐2 was performed as previously described 34 , 35 . Briefly, the primer and probe sets (NC1 and NC2) were NC1 Forward: 5′‐GACCCCAAAATCAGCGAAAT‐3′, NC1 Reverse: 5′‐TCTGGTTACTGCCAGTTGAATCTG‐3′, NC1 Probe: 5′‐FAM‐ACCCCGCATTACGTTTGGTGGACC‐BHQ1‐3′.…”

Therapeutic Effect of C-Vx Substance in K18-hACE2 Transgenic Mice Infected with SARS-CoV-2

“…The volume-per-weight calculation was not performed because the newly developed C-Vx is a biological product [16]. As a result, in each group, the same volume of C-Vx was given to animals of the same weight living in the same environments [20,30,31].…”