Investigation of functional gene polymorphisms: IL‐1B, IL‐6 and TNFA in benign migratory glossitis in Brazilian individuals

Abstract

Our findings demonstrate that the polymorphism +3954 IL-1B is associated with an increased risk of BMG development and suggest a genetic basis for disease development.

Tumor necrosis factor‐alpha −308G/A single nucleotide polymorphism and red‐complex periodontopathogens are independently associated with increased levels of tumor necrosis factor‐α in diseased periodontal tissues

“…DNA was extracted from epithelial buccal cells using sequential phenol and chlorophorm extraction procedures and precipitated with salt/ethanol solution (6.0 m GuSCN, 65 m m Tris‐HCL, with 450 μL 70% ethanol) (19). For genotyping TNFA −308, DNA fragments were amplified by use of the following primer pair: 5′‐AGGCAATAGGTTTTGAGGGCCAT‐3′ and 5′‐TCCTCCCTGCTCCGATTCCG‐3′ (19). The polymerase chain reaction (PCR) was performed in a 25‐μL reaction mixture containing PCR buffer (Promega Corporation, Madison, Wisconsin, USA), 2.5 m m MgCl 2 , 10 m m dNTPs, 100 n m each primer, 200 ng of sample DNA and 2 U Taq polymerase.…”

Association between interleukin gene polymorphisms and risk of recurrent oral ulceration

“…Previous studies have shown that polymorphisms of cytokines have been associated with risk of oral mucosal disease (Bazrafshani et al, 2002;Bai et al, 2007;Xavier et al, 2007;Guimarães et al, 2007a;Kalkan et al, 2013). Kalkan et al (2013) reported that intron 3 VNTR polymorphism in the IL-4 gene plays an important role in the development of recurrent aphthous stomatitis in the Turkish population.…”

“…Xavier et al (2007) reported that IL-6 and TNF-α gene polymorphisms are associated with occurrence of oral lichen planus. For ROU, Guimarães et al (2007a) reported that polymorphism of high IL-1β production was correlated with an increased risk of ROU. IL-6 gene polymorphisms can increase susceptibility to ROU (Bazrafshani et al, 2002).…”

Analysis of p16_{<i>CDKN2A</i>} Methylation and HPV-16 Infection in Oral Mucosal Dysplasia

“…The importance of functional genetic polymorphisms has been demonstrated in the vast majority of oral diseases [54][55][56] . In the current study, the T allele of the dnmt3b (C46359T) polymorphism was not associated with ED or p16 CDKN2A methylation status.…”