Investigating the mechanisms of glyphosate resistance in Lolium multiflorum

Abstract

Evolved resistance to the herbicide glyphosate has been reported in eleven weed species, including Lolium multiflorum. Two glyphosate-resistant L. multiflorum populations were collected, one from Chile (SF) and one from Oregon, USA (OR), and the mechanisms conferring glyphosate resistance were studied. Based on a Petri dish dose-response bioassay, the OR and the SF populations were two and fivefold more resistant to glyphosate when compared to the susceptible (S) population, respectively; however, based on a whole-plant dose-response bioassay, both OR and SF populations were fivefold more resistant to glyphosate than the S population, implying that different resistance mechanisms might be involved. The S population accumulated two and three times more shikimic acid in leaf tissue 96 h after glyphosate application than the resistant OR and SF populations, respectively. There were no differences between the S and the glyphosate-resistant OR and SF populations in 14C-glyphosate leaf uptake; however, the patterns of 14C-glyphosate translocation were significantly different. In the OR population, a greater percentage of 14C-glyphosate absorbed by the plant moved distal to the treated section and accumulated in the tip of the treated leaf. In contrast, in the S and in the SF populations, a greater percentage of 14C-glyphosate moved to non-treated leaves and the stem. cDNA sequence analysis of the EPSP synthase gene indicated that the glyphosate-resistant SF population has a proline 106 to serine amino acid substitution. Here, we report that glyphosate resistance in L. multiflorum is conferred by two different mechanisms, limited translocation (nontarget site-based) and mutation of the EPSP synthase gene (target site-based).

A Modified phosphate-carrier protein theory is proposed as a non-target site mechanism For glyphosate resistance in weeds

“…Other resistant biotypes of ELEIN from Malaysia were found to have the mutation P 106 T (Ng et al, 2003). The P 106 T mutation was also detected in a population of Lolium rigidum from Australia (Wakelin & Preston, 2006) and in a population of Lolium multiflorum from Chile (Perez-Jones et al, 2007).…”

First case of glyphosate resistance in France

“…cDNA synthesis was carried out from 2 μg of total RNA using a M-MLV (Moloney Murine Leukemia Virus) Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) in combination with oligo (dT) 12-18 and random nonamers (Amersham Biosciences, Amersham, UK) according to the manufacturer's instructions. To amplify the EPSPS gene, primers previously designed by Perez-Jones et al (2007) (forward: 5′ AGCTGTAGTCGTTG GCTGTG 3′; reverse: 5′ GCCAAGAAATAGCTCGCACT 3′) were used. These primers expand a 543-bp fragment of the EPSPS gene that contains the mutation site described as conferring resistance to glyphosate in Lolium spp.…”

Evaluation of the Mechanism Responsible for the Low-Level Resistance to Glyphosate in Goosegrass

“…The extraction of shikimate was performed according to modifications by Perez-Jones et al (2007). The leaf tissue used in the extraction of shikimate came from the fourth fully expanded leaf, collected 24 hours after application (HAT) and the interval between the application of glyphosate and the collection of the material was determined in a preliminary experiment (data not shown).…”