Investigating a persistent odor at an aircraft seat manufacturer

Abstract

An aircraft seat manufacturing company requested a NIOSH health hazard evaluation to help identify a strong odor that had persisted throughout the facility for over a year. Employees reported experiencing health effects thought to be related to the odor. We collected and analyzed area air samples for volatile organic compounds, endotoxin, bacterial and fungal metagenome, and metalworking fluid aerosol. Bulk metalworking fluid samples were analyzed for endotoxin, bacterial and fungal metagenome, and viable bacteria and fungus. We also evaluated the building ventilation systems and water diversion systems. Employees underwent confidential medical interviews about work practices, medical history, and health concerns. Based on our analyses, the odor was likely 2-methoxy-3,5-dimethylpyrazine. This pyrazine was found in air samples across the facility and originated from bacteria in the metalworking fluid. We did not identify bacteria known to produce the compound but bacteria from the same Proteobacteria order were found as well as bacteria from orders known to produce other pyrazines. Chemical and biological contaminants and odors could have contributed to health symptoms reported by employees, but it is likely that the symptoms were caused by several factors. We provided several recommendations to eliminate the odor including washing and disinfecting the metalworking machines and metalworking fluid recycling equipment, discarding all used metal-working fluid, instituting a metalworking fluid maintenance program at the site, and physically isolating the metalworking department from other departments.

Microbial hazards during harvesting and processing at an outdoor United States cannabis farm

“…Sequencing of 16S rRNA and ITS regions is a method increasingly used in occupational health studies to assess the diversity of bacteria and fungi in air and dust samples. (17, 18, 21) This methodological approach overcomes some of the limitations associated with traditional methods of microbial exposure assessment, such as elucidating non-culturable fungi from viable fungi or microscopically differentiating fungal spores that share the same morphology. (15) In the present study, analysis of personal and area air samples derived from an outdoor cannabis farm that utilized organic practices revealed an expected broad diversity of bacterial and fungal sequences.…”

“…Extracted bacterial (16S rRNA) and fungal (ITS) genomic DNA were targeted for PCR amplification as previously described. (15, 17, 18) Briefly, bacterial 16S rRNA genes were amplified using Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA) and the highly conserved primer pair p8FPL (AGTTTGATCCTGGCTCAG) and p806R (GGACTACCAGGGTATCTAAT) using a modified method of McCabe et al (19) The PCR conditions included initial denaturation at 95 °C for 4 minutes, followed by 33 cycles of denaturation at 94 °C for 1 minute, annealing at 55 °C for 1 minute, and extension at 72 °C for 2 minutes, and completed with a final extension at 72 °C for 10 minutes. Fungal ITS1 and ITS2 regions were amplified using the primer pair Fun18Sf (forward, 5’-TTGCTCTTCAACGAGGAAT) and ITS4 (reverse, 5’- TCCTCCGCTTATTGATATGC) and Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) according to the methods previously described.…”

Gaseous and Particulate Content of Laser Tattoo Removal Plume

“…Genomic DNA was extracted from the air samples and bacterial 16S ribosomal DNA regions were sequenced and analyzed as previously described. 24 The sequence data was used to identify the assemblage of bacteria by comparing the 16S sequences to sequences banked in the National Center for Biotechnology Information database.…”

Collection and Extraction of Occupational Air Samples for Analysis of Fungal DNA

“…Conduct air sampling for time periods ranging from as little as 10 min to a full 8 h work shift, depending on the environment10,18,19 …”