Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.

Abstract

Insertion of introns into cloned cDNA of two isolates of the plant potyvirus pea seedborne mosaic virus facilitated plasmid amplification in Escherichia coli. Multiple stop codons in the inserted introns interrupted the open reading frame of the virus cDNA, thereby terminating undesired translation of virus proteins in E. coli. Plasmids containing the full-length virus sequences, placed under control of the cauliflower mosaic virus 35S promoter and the nopaline synthase termination signal, were stable and easy to amplify in E. coli if one or more introns were inserted into the virus sequence. These plasmids were infectious when inoculated mechanically onto Pisum sativum leaves. Examination of the cDNA-derived viruses confirmed that intron splicing of in vivo transcribed pre-mRNA had occurred as predicted, reestablishing the virus genome sequences. Symptom development and virus accumulation of the cDNA derived viruses and parental viruses were identical. It is proposed that intron insertion can be used to facilitate manipulation and amplification of cloned DNA fragments that are unstable in, or toxic to, E. coli. When transcribed in vivo in eukaryotic cells, the introns will be eliminated from the sequence and will not interfere with further analysis of protein expression or virus infection.

Efficacy of acetaminophen in skin B16-F0 melanoma tumor-bearing C57BL/6 mice

“…This system consists of RNAi sequences cloned in plasmids under the U1 promoter, meant to express 22-mer ds-RNA sequences after transient or stable transfections. In initial experiments, the plasmids were amplified in E. coli and the DNAs purified by standard procedures (17). The RNAi insert sequences found in these plasmids were GTAGCCGATTGGAGGAGTACA, and CCAGAAGCTGACAGGAGATGA, and GACGACTCTTG GTGAGAAGAA, and TGAGCTTGCTGTGTCGTCACA and the non-specific scrambled sequence ggaatctcattcgatgc atac was used as a control.…”

Desarrollo De Un Vector Para La Expresión Simultánea De Múltiples Proteínas en Plantas Basado en El Potyvirus Del Grabado Del Tabaco

“…To overcome this limitation different strategies have been proposed. The most accepted consists of interrupting the viral cDNA with introns that avoid the expression of the viral toxic product in bacteria and that are properly processed by splicing in the host (Johansen, 1996). This strategy has some drawbacks such as the undesired increment in plasmid size, that is only applicable to plasmids devoted to trigger infection from a DNA expressed in the cell nucleus and, in some cases, it might become inconvenient interrupting the viral cDNA with exogenous sequences.…”

“…Adicionalmente, existe la alternativa de insertar intrones eucarióticos en la secuencia viral, para evitar la posible expresión de secuencias que resulten tóxicas, y los cuales son procesados in vivo una vez se han infectado las células huésped. Johansen (1996) empleó esta técnica exitosamente para estabilizar en E. coli el cDNA completo de dos ailsados del virus del mosaico del guisante transmitido por semilla (Pea seedborne mosaic virus, PSbMV). También se han insertado intrones para estabilizar en bacterias clones de otros virus como el causante de la sharka de los frutales de hueso (PPV) (López-Moya y García, 2000), el flavivirus de la encefalitis japonesa (Japanese encephalitis flavivirus, JE) (Yamshchikiv et al, 2001), y el TGEV (González et al, 2002).…”

“…Habitualmente, las estrategias para mejorar la estabilidad de los clones virales en bacterias se basan en modificar de alguna manera la propia secuencia viral. Por ejemplo, se pueden introducir intrones para interrumpir genes potencialmente tóxicos para E. coli (Johansen, 1996), o realizar mutaciones que impidan la expresión de los mismos (Satyanarayana et al, 2003). Sin embargo, en este caso se optó por manipular las secuencias exógenas al genoma viral dentro del vector plasmídico, intentando conservar solamente aquellos elementos necesarios para su correcta replicación y mantenimiento en las bacterias, como el origen de replicación o genes de resistencia a antibióticos.…”

“…Perhaps, the most accepted is the interruption of potentially toxic sequences in viral cDNA with introns, which are properly processed during viral RNA expression in the host. This strategy was proposed to stabilize a plasmid with a clone of the potyvirus Pea seedborne mosaic virus (Johansen, 1996) and has been successfully used with other potyviruses like Plum pox virus (López-Moya and García, 2000) or other RNA viruses including some from animal hosts (Gonzalez et al, 2002;Yamshchikov et al, 2001). This strategy requires, however, the interruption of the viral cDNA with exogenous sequences and the expression of the viral RNA from a DNA in the nucleus of the host cell which might not be desirable in some instances.…”