“…RNA 3p10LA9 pppGGAUUUCCACCUUCGGGGGAAAUCC were transcribed in vitro using T7 RNA polymerase as described previously ( 14 , 41 ). The reactions contain 40 mm Hepes pH 7.5, 30 mm MgCl 2 , 2 mm spermidine, 10 mm DTT, 0.01% Triton X-100, 5 mm GTP, and 4 mm NTP (CTP, ATP, and UTP), 1 μm DNA template (IDT), 400 to 600 nm T7 RNA polymerase, 0.2 U·mL −1 thermostable inorganic pyrophosphatase (New England Biolabs) for overnight at 37 °C.…”