Intramuscular administration of expression plasmids encoding interferon-γ receptor/IgG1 or IL-4/IgG1 chimeric proteins protects from autoimmunity

Safety of a GM-CSF adjuvant-plasmid DNA malaria vaccine

“…The human GM-CSF pDNA was included in the vaccine to increase the immunogenicity as GM-CSF is known to attract dendritic cells to the site of administration and enhance the maturation of dendritic cell precursors which play an important role in antigen presentation. [19][20][21][22][23][24] While co-administration of GM-CSF pDNA has been demonstrated to enhance the immunogenicity of pDNA vaccines, [25][26][27][28][29][30][31][32][33][34][35][36][37][38][39][40][41][42] the overexpression of GM-CSF in transgenic mice has been demonstrated to result in adverse pathology associated with overaccumulation of macrophages in tissues, accumulation of macrophages in the peritoneal and pleural cavities, retinal damage, muscle wasting, and a fatal tissue damage syndrome. 37 Thus, the inclusion of GM-CSF in the vaccine raised several important theoretical safety concerns which had to be addressed before the vaccine could be taken into a clinical trial with healthy volunteers.…”

“…In these studies, the chimeric IL-4/IgG1 protein was readily detected in the muscle but could not be detected in the serum of any of the mice following intramuscular administration of the IL-4/IgG1 encoding pDNA. 41 In animals that received the MuStD0 5-mGM-CSF vaccine, muscle GM-CSF expression peaked at 2 days after administration, then rapidly declined to approximately 1% of the peak by day 10 after administration, and could no longer be detected by day 14 after administration. The administration of GM-CSF pDNA plus control pDNA (backbone vector lacking the malaria antigen coding sequences), or GM-CSF pDNA alone, resulted in similar early pharmacokinetics with expression peaking at 1-3 days after administration.…”

DNA vaccination with an insulin construct and a chimeric protein binding to both CTLA4 and CD40 ameliorates type 1 diabetes in NOD mice

“…26,46,47 This mutant B7.1 (a gift from Dr Yang Liu, Ohio University) binds to CTLA4 but not to CD28. 48,49 The extracellular sequence of CD40L (mouse CD40L cDNA from ATCC, Manassas, VA, USA) was amplified by PCD (5 0 primer C: AAGAGCCTCTCCCACTCTCCTGGTAG ATTGGATAAGGTCGAAGAGGAA and 3 0 primer D: TAGTAGGAATTCACTGTTCAGAGTTTGAGTAAGCCA).…”

Immunopathology and the gene therapy of lupus

“…Transfer of cDNA encoding these molecules protects against several autoimmune diseases. 122 Prud'homme and co-workers [136][137][138] constructed an expression plasmid encoding IFN-gR/IgG1-Fc fusion proteins. The appropriate murine cDNA segments were inserted into the plasmid VR-1255 (abbreviated as VR; Vical Inc., San Diego, CA, USA), which is exceptionally effective in muscle.…”

“…injections (100 mg naked DNA/muscle into two muscles, administered twice) of the IFN-gR/IgG1-Fc plasmid in mice resulted in IFN-gR/IgG1-Fc serum levels exceeding 100 ng/ml for months after treatment. 136,137 Higher levels (4200 ng/ml) were produced by repeated DNA injections. The high-level and long-term expression of this vector, compared with many other plasmid vectors, may be related to the neutralization of IFN-g, since this cytokine can suppress transcription promoted by CMV IE-EP elements.…”