Intracellular localization of Saffold virus Leader (L) protein differs in Vero and HEp-2 cells

Abstract

The Saffold virus (SAFV) genome is translated as a single long polyprotein precursor and co-translationally cleaved to yield 12 separate viral proteins. Little is known about the activities of SAFV proteins although their homologs in other picornaviruses have already been described. To further support research on functions and activities of respective viral proteins, we investigated the spatio-temporal distribution of SAFV proteins in Vero and HEp-2 cells that had been either transfected with plasmids that express individual viral proteins or infected with live SAFV. Our results revealed that, with the exception of the Leader (L) protein, all viral proteins were localized in the cytoplasm at all the time points assayed. The L protein was found in the cytoplasm at an early time point but was subsequently translocated to the nucleus of HEp-2, but not Vero, cells. This was observed in both transfected and infected cells. Further mutational analysis of L protein revealed that Threonine 58 of the Ser/Thr-rich domain of L protein is crucial for protein trafficking between the cytoplasm and nucleus in HEp-2 cells. These findings contribute to a deeper understanding and stimulate investigation of the differetial cellular responses of HEp-2 cells in comparison to other mammalian cell lines during SAFV infection.

The Saffold Virus-Penang 2B and 3C Proteins, but not the L Protein, Induce Apoptosis in HEp-2 and Vero Cells

“…The plasmids used in this study were pXJ40-Myc-L, -1D, -2A, -2B, -2B D78-96 , -2C, -3A, -3C, and -3D, as well as pXJ40-Myc-BAX and pXJ40-Myc-DA L. The construction of plasmids used for the expression of viral proteins in HEp-2 and Vero cells were described previously (Xu et al 2016). The plasmid pXJ40-Myc-2B D78-96 was constructed using In-fusion Ò HD cloning kit (Clontech, CA, USA) according to the manufacturer's protocols with the pXJ40-Myc-2B plasmid as the template and GTTCTTTACCTAC ATACCAATGATAGCGTCTTCAACTGG (Forward primer) and ATGTAGGTAAAGAACTGAGGCGGCAACC (Reverse primers) as the primers.…”

“…To screen for SAFV protein(s) responsible for inducing apoptotic activity in HEp-2 and Vero cells, the vectors encoding the SAFV L, 1D, 2A, 2B, 2C, 3A, 3C, 3D, or BAX, or TMEV DA L protein, as well as empty vector, were initially transfected separately into HEp-2 cells or Vero cells to assay their expression profile. The result of the expression profile of respective Myc-tagged proteins by Western blot assay had been described (Xu et al 2016). The expression levels of respective protein in Hep-2 cells and Vero cells transfected pXJ40-Myc-SAFV virus gene constructs, as well as pXJ40-Myc-DA L and pXJ40-Myc-BAX, at 24 h post-transfection were compared and shown in Table 1.…”

“…Proteins expressed in respective cell line HEp-2 100 a 97 90 75 68 80 70 85 96 95 Vero 100 a 125 120 115 95 110 106 101 94 98 a The expression level of SAFV L protein is set as 100 for comparison. The expression levels of the respective Myc-tagged protein were measured and calculated from the expression profiles by Western blot assay in the previous study (Xu et al 2016). The Transmembrane Domain of the SAFV 2B Protein…”

“…Taking into consideration that the 3C protein of SAFV was degraded by the cellular ubiquitin/26S proteasome after expression (Xu et al 2016), we focused on the apoptotic activity of the 2B protein. SAFV 2B protein contains a transmembrane domain located between amino acid 78 and 96 of the sequence (Fig.…”