Interleukin-6 Knockout Inhibits Senescence of Bone Mesenchymal Stem Cells in High-Fat Diet-Induced Bone Loss

Abstract

Obesity, a chronic low-grade inflammatory state, not only promotes bone loss, but also accelerates cell senescence. However, little is known about the mechanisms that link obesity, bone loss, and cell senescence. Interleukin-6 (IL-6), a pivotal inflammatory mediator increased during obesity, is a candidate for promoting cell senescence and an important part of senescence-associated secretory phenotype (SASP). Here, wild type (WT) and (IL-6 KO) mice were fed with high-fat diet (HFD) for 12 weeks. The results showed IL-6 KO mice gain less weight on HFD than WT mice. HFD induced trabecular bone loss, enhanced expansion of bone marrow adipose tissue (BMAT), increased adipogenesis in bone marrow (BM), and reduced the bone formation in WT mice, but it failed to do so in IL-6 KO mice. Furthermore, IL-6 KO inhibited HFD-induced clone formation of bone marrow cells (BMCs), and expression of senescence markers (p53 and p21). IL-6 antibody inhibited the activation of STAT3 and the senescence of bone mesenchymal stem cells (BMSCs) from WT mice in vitro, while rescued IL-6 induced senescence of BMSCs from IL-6 KO mice through the STAT3/p53/p21 pathway. In summary, our data demonstrated that IL-6 KO may maintain the balance between osteogenesis and adipogenesis in BM, and restrain senescence of BMSCs in HFD-induced bone loss.

Langerhans cells and cDC1s play redundant roles in mRNA-LNP induced protective anti-influenza and anti-SARS-CoV-2 responses

“…Forward (5’) Pr8 NP: CAGCCTAATCAGACCAAATG, Reverse (3’): TACCTGCTTCTCAGTTCAAG. Forward (5’) β-Actin AGATTACTGCTCTGGCTCCTAGC and Reverse (3’): ACTCATCGTACTCCTGCTTGCT (Garcia et al, 2020; Li et al, 2021).…”

“…The influenza dose used in these studies was previously described (Pardi et al, 2018a;Zens et al, 2016), while the SARS-CoV-2 dose was determined in house using hACE-2 mice (Suppl. ACTCATCGTACTCCTGCTTGCT (Garcia et al, 2020;Li et al, 2021).…”

Gut microbiota and bone metabolism

“…152 However, recent studies have found that excess dietary fat intake can disrupt bone remodeling, can accelerate bone aging, and is an independent and controllable risk factor for osteoporosis. [153][154][155] A HFD induces chronic low-grade inflammation concomitant with an increase in the levels of pro-inflammatory cytokines (IL-1, IL-6, and TNFα), 156,157 aggravates oxidative stress, 158 affects the bone marrow microenvironment, and ultimately shifts the osteoblastic/ adipogenic differentiation balance among BMSCs. 21 This not only reduces the formation and differentiation of osteoblasts but also leads to the accumulation of BMAs, which inhibit osteoblast generation and promote osteoclast differentiation via leptin and adiponectin.…”

“…Traditionally, a HFD was believed to be beneficial for bone health because it often leads to weight gain, and high body weight is widely considered to be a protective factor for bone health 152 . However, recent studies have found that excess dietary fat intake can disrupt bone remodeling, can accelerate bone aging, and is an independent and controllable risk factor for osteoporosis 153‐155 . A HFD induces chronic low‐grade inflammation concomitant with an increase in the levels of pro‐inflammatory cytokines (IL‐1, IL‐6, and TNF‐α), 156,157 aggravates oxidative stress, 158 affects the bone marrow microenvironment, and ultimately shifts the osteoblastic/adipogenic differentiation balance among BMSCs 21 .…”

MicroRNA-29a in Osteoblasts Represses High-Fat Diet-Mediated Osteoporosis and Body Adiposis through Targeting Leptin

“…Accumulating studies have revealed osteogenesis downregulation [9], fatty marrow, bone mass loss [10], and biomechanical property repression [11] in mice upon HFD feeding. Oxidative stress [12], inflammatory cytokine overproduction [13], and Wnt signaling loss [14] aggravate the development of HFD-induced bone loss. In addition, epigenetic pathways, including histone lysine demethylase [15], RNA demethylase [16], and long non-coding RNA, in osteogenic cells [17] regulates HFD-induced bone mass loss and peripheral fat metabolism.…”