Interferon Tau (IFNt) and Interferon-Stimulated Genes (ISGs) Expression in Peripheral Blood Leukocytes and Correlation with Circulating Pregnancy-Associated Glycoproteins (PAGs) during Peri-Implantation and Early Pregnancy in Buffalo Cows

Abstract

The objective of this study was to analyze interferon-stimulated genes (ISGs) and interferon tau (IFNt) gene expression in peripheral blood leukocytes during the peri-implantation period and until 40 days of pregnancy in buffalo cows. Relationships were also examined between the expression of ISGs and IFNt and pregnancy-associated glycoproteins (PAGs) peripheral plasma concentration. Buffalo cows were synchronized and artificially inseminated (d 0). Blood samples were collected on days 0, 18, 28 and 40 after artificial insemination (AI) for peripheral blood mononuclear cells (PBMCs) and polymorphonuclear leukocytes (PMNs) isolation and PAGs radioimmunoassay analysis. The study was carried out on 21 buffalo cows divided ex post into Pregnant (n = 12) and Non-pregnant (n = 9) groups. Steady state levels of OAS1, MX2, ISG15 and IFNt mRNA were measured by RT-qPCR and their estimated marginal means (p < 0.01 for all) were higher in pregnant than non-pregnant buffaloes, both in PBMCs and PMNs. In PBMCs, pairwise comparisons showed that OAS1 and MX2 expressions differed between pregnant and non-pregnant buffaloes on all the days of observation (p < 0.001), while significant differences in ISG15 and IFNt started from day 28 post-AI (p < 0.05). In PMNs, ISG15 expression differed between groups only at days 18 and 28 (p < 0.001), while comparisons were always significant for IFNt (p < 0.05). The expression of all genes, except ISG15 as determined in PMNs, was positively associated with PAGs plasma concentrations (p < 0.05). This work showed a significant increase in ISGs and IFNt expressions in PBMCs and PMNs in buffalo during the peri-implantation period and early pregnancy, and their correlation with PAGs plasma concentration.

Gene Expression of Pregnancy-Associated Glycoproteins-1 (PAG-1), Interferon-Tau (IFNt) and Interferon Stimulated Genes (ISGs) as Diagnostic and Prognostic Markers of Maternal-Fetal Cellular Interaction in Buffalo Cows

“…This finding is in line with the observations made by Buragohain et al [65] who showed an increase of MX2 gene expression in the peripheral blood of pregnant buffalo cows on days 14 and 28, with a ten-fold and fourteen-fold increase in plasma protein levels, respectively. This trend of MX2 expression was also observed in our previous study [38] in which mRNA ISG expression was either evaluated in PBMCs or PMNs.…”

“…However, in our recent study [38] significant differences in INFt expression were observed in PBMCs between pregnant and nonpregnant buffaloes on days 28 and 40 after AI. In our opinion, these dissimilarities may be due to differences between the methodology applied in this study and the methodology used in our previous study such as different primer-sequence (Fw: CCATTCTGACCGTGAAGAAGTA-Rev: TCATCTCCACTCTGATGATTTCC, (RefSeq.…”

“…In our opinion, these dissimilarities may be due to differences between the methodology applied in this study and the methodology used in our previous study such as different primer-sequence (Fw: CCATTCTGACCGTGAAGAAGTA-Rev: TCATCTCCACTCTGATGATTTCC, (RefSeq. : AY535404.1) [38] vs Fw: CATCTTCCCCATGGCCTTC -Rev: CAACCAAGAGATTCTGCCGG, (RefSeq. XM_025281435.1) respectively) and different fluorescence detection methods in qPCR (Probe system vs Sybr Green, respectively).…”

Role of Genetic Variants AGT rs699 and ACE2 rs2106809 in Increasing the Risk and Severity of COVID-19 Infection in Iraqi Patients

“…Interferon Tau (IFNT) or ovine trophoblast protein-1 oTP-1 is a pregnancy recognition signal in ruminants, secreted by trophectoderm after embryo elongation on day 10 and ceases after day 21 [5][6][7][8]. In addition to its role in pregnancy recognition, IFNT has other functions such as anti-luteolytic and CL protective [9], preventing rejection and supporting progesterone secretion [10].…”

Investigation of conceptus stimulated gene expression in buffalo peripheral blood mononuclear cells as potential diagnostic markers of early pregnancy

“…Likewise, novel transcripts such as interleukin 6 ( IFI6), radical S-adenosyl methionine domain containing 2 (RSAD2), interferon induced protein 44 (IFI44), 2′-5′-oligoadenylate synthetase 2 (OAS2 ), galectin 3 binding protein (LGALS3BP), interferon induced transmembrane protein 2 (IFITM2), TNF superfamily member 13B (TNFSF13B), C-type lectin domain family 3 member B (CLEC3B), and dermokine ( DMKN) were expressed in bovine PBMCs during early pregnancy (Rocha et al ., 2020). Other studies showed increased protein expression of myxovirus resistance protein 2 (MX2: Buragohain et al, 2016) and recombinant ISG15 (the product of interferon-stimulated gene 15: Batra et al ., 2018) as well as mRNA expression of ISG15, MX2, 2′-5′-oligoadenylate synthetase 1 ( OAS1 ) and IFNT in PBMC of early pregnant buffalo (Casano et al ., 2022).…”