Interferon Lambda Family along with HTLV-1 Proviral Load, Tax, and HBZ Implicated in the Pathogenesis of Myelopathy/Tropical Spastic Paraparesis

Abstract

HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) is a chronic neuroinflammatory disease related to human T lymphotropic virus type 1 (HTLV-1) infection. Interferon type III (IFN-λ), which includes IL28, IL29, and IL28R, and affects the outcome of viral infections, might be complicated in the progression of HAM/TSP. Here, we investigated the host-virus interactions in the manifestation of HAM/TSP, using IL28B, IL29, IL28R, HTLV-1 Tax, HTLV-1 basic leucine zipper factor (HBZ), and proviral load (PVL). The study groups consisted of 20 patients with HAM/TSP, 20 asymptomatic HTLV-1 carriers (ACs), and 20 healthy controls (HCs). The means of PVL, Tax, and HBZ gene expressions in the HAM/TSP group (p = 0.004, 0.006, and < 0.0001, respectively) were significantly higher than in the AC group. The comparison of IL28B, IL29, and IL28R expression in the HAM/TSP, AC, and HC groups revealed no significant difference between the first 2, but lower concentrations in the HCs (IL28B: p = 0.03, 0.01; IL29: p = 0.07, 0.01; and IL28R: p < 0.0001, respectively). In the HAM/TSP group, correlations were seen between Tax and HBZ (R = 0.61, p = 0.004) and between Tax and IL29 (R = 0.45, p = 0.04). Negative correlations were observed between Tax and IL28B (R = –0.49, p = 0.02) and between HBZ and IL28R (R = –0.43, p = 0.06). In the ACs, an inverse correlation was found between Tax and IL28B (R = –0.42, p = 0.06). These findings suggest that IL29, IL28B, and IL28R interfere in the infection of HAM/TSP, mainly via Tax activation.

An insight to HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) pathogenesis; evidence from high-throughput data integration and meta-analysis

“…Following primers and probes were designed and used to determine the expression levels of STAT1, PSMB8, TAP1 : STAT1 (forward primer: 5ʹ-AACATGGAGGAGTCCACCAATG-3ʹ, reverse primer: 5ʹ-GATCACCACAACGGGCAGAG-3ʹ and TaqMan probe: FAM- TCTGGCGGCTGAATTTCGGCACCT -BHQ1), PSMB8 (forward primer: 5ʹ-GTTCAGATTGAGATGGCCCATG-3ʹ, reverse primer: 5ʹ-CGTTCTCCATTTCGCAGATAGTAC-3ʹ and TaqMan probe: FAM- CCACCACGCTCGCCTTCAAGTTCC -BHQ1), TAP1 (forward primer: 5ʹ-TACCGCCTTCGTTGTCAGTTATG-3ʹ, reverse primer: 5ʹ-GAGCCCAGGCAGCCTAGAAG-3ʹ and TaqMan probe: Fam-CGCACAGGGTTTCCAGAGCCGCC-BHQ1). The primers and probes of Tax and HBZ were synthesized according to published data [33]. The relative 2 standard curves real-time PCR was carried out on the cDNA samples using TaqMan master mix (Takara, Otsu, Japan) and a Q-6000 machine (Qiagen, Germany).…”

Comprehensive high-throughput meta-analysis of differentially expressed microRNAs in transcriptomic datasets reveals significant disruption of MAPK/JNK signal transduction pathway in Adult T-cell leukemia/lymphoma

“…The enzyme-linked immunosorbent assay (ELISA, Diapro, Italy) was used to perform the serology test for HTLV-1. PCR was then employed to confirm the serology results [ 31 ]. The inclusion criteria for healthy donors were participants with no active acute infectious disease, no concurrent drug use, and no diagnosed genetic abnormalities or defects.…”

Influence of Immunogenetic Biomarkers in the Clinical Outcome of HTLV-1 Infected Persons

“…However, high levels of IL-28B were associated with the development of ATLL and HAM [81]. High IL28B expression levels are mainly associated with high levels of Tax protein [82] as a consequence of the disorganized proliferation of CD4 + T lymphocytes leading to marked development of the inflammatory process characteristics, mainly HAM. Another study showed that patients with the CT/TT genotype of rs12979860 polymorphism have a greater proviral load than those with the CC genotype, thus suggesting that the presence of *T allele might be associated with the pathogenesis of infection and disease outcome contributing to the progression to HAM [64].…”