Interactions of the DNA Polymerase X of African Swine Fever Virus with Double-stranded DNA. Functional Structure of the Complex

Jezewska, Maria J.; Bujalowski, Paul J.; Bujalowski, Wlodzimierz

doi:10.1016/j.jmb.2007.06.054

Cited by 21 publications

(42 citation statements)

References 63 publications

(317 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The dsRNA and dsDNA 30-mer were random sequence oligomers containing ϳ60% of GC base pairs with the sequence GGAGUCCACGACUUCGCAGGCUCGUUACGU, with T replacing U in the case of the DNA. The double-stranded conformations of the nucleic acids have been obtained by mixing oligomers with the complementary strands, heating the sample to 95°C, and slowly cooling for a period of ϳ4 h. The integrity of the dsRNA and dsDNA 30-mer has been tested using UV melting and analytical ultracentrifugation methods (27)(28)(29).…”

Section: Methodsmentioning

confidence: 99%

Full-length Dengue Virus RNA-dependent RNA Polymerase-RNA/DNA Complexes

Szymanski

Jezewska

Bujalowski

et al. 2011

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Fundamental aspects of interactions of the Dengue virus type 3 full-length polymerase with the single-stranded and doublestranded RNA and DNA have been quantitatively addressed. The polymerase exists as a monomer with an elongated shape in solution. In the absence of magnesium, the total site size of the polymerase-ssRNA complex is 26 ؎ 2 nucleotides. In the presence of Mg 2؉ , the site size increases to 29 ؎ 2 nucleotides, indicating that magnesium affects the enzyme global conformation. The enzyme shows a preference for the homopyrimidine ssRNAs. Positive cooperativity in the binding to homopurine ssRNAs indicates that the type of nucleic acid base dramatically affects the enzyme orientation in the complex. Both the intrinsic affinity and the cooperative interactions are accompanied by a net ion release. The polymerase binds the dsDNA with an affinity comparable with the ssRNAs affinity, indicating that the binding site has an open conformation in solution. The lack of detectable dsRNA or dsRNA-DNA hybrid affinities indicates that the entry to the binding site is specific for the sugar-phosphate backbone and/or conformation of the duplex. The dengue virus (DENV)2 is a member of the Flaviviridae family and the etiological agent of dengue fever, a disease affecting worldwide ϳ100 million people each year (1-5). The Flaviviridae family includes such human pathogens as tick-borne encephalitis virus, hepatitis C virus, West Nile virus, yellow fever virus, and Japanese encephalitis virus (1-5). The dengue virus exists in four distinct types, DENV1, -2, -3, and -4, which show ϳ60% genomic sequence identity (1). The dengue fever often develops into the dengue hemorrhagic fever, an acute form of the disease, possibly as a result of sequential infection with different types of the virus. It is characterized by a significant mortality, particularly for individuals with a weakened or undeveloped immune system. The small, 10.7-kbp positive strand RNA genome of the dengue virus encodes only 10 proteins: three structural proteins (capsid, premembrane, and envelope proteins) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5 proteins) (3, 6 -8). The entire viral genome is translated as a single polyprotein, subsequently cleaved by viral and cellular proteases into functional entities.The NS5 protein is the viral replicative RNA-dependent RNA polymerase (1, 3, 6 -8). The primary structure of the fulllength polymerase encompasses 900 amino acids (i.e. it is the largest of the nonstructural proteins of the dengue virus) (6 -10). The enzyme is built of two functional domains (6 -10). The N-terminal domain includes the first 263 amino acids. It functions as a methyltransferase (MTase), whose activity is necessary for viral RNA recognition by the host cell translational apparatus. Correspondingly, amino acids ϳ273-906 form the polymerase domain, containing the active site of the RNA synthesis (Fig. 1a) (6 -8). The crystal structures of the isolated N-terminal and polymerase domains have been determined up t...

show abstract

Section: Methodsmentioning

confidence: 99%

Full-length Dengue Virus RNA-dependent RNA Polymerase-RNA/DNA Complexes

Szymanski

Jezewska

Bujalowski

et al. 2011

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…Thermodynamic studies give the information necessary to understand the molecular forces that drive the complex formation. Moreover, they can provide information about functionally significant structural changes occurring in participating reacting species, as a result of the interactions [1–21]. Major goals of quantitative binding studies are to obtain the chief characteristics of the binding reaction that include: (1) The maximum stoichiometry of the formed complexes; (2) The presence, character, and extent of cooperative interactions; (3) Macroscopic and intrinsic binding constants; (4) Nature of interactions involved in formation of the studied complexes, i.e ., the dependence of equilibrium binding parameters on solution variables (temperature, pressure, pH, salt concentration, type of salt, etc .…”

Section: Introductionmentioning

confidence: 99%

“…The indirect methods, which include spectroscopic titration techniques, are based on observing a physico-chemical signal ( e.g ., fluorescence intensity), proportional to the macromolecule or ligand concentrations and accompanying the formation of the complex, not the total average degree of binding [1–6,8–10,12–15,17–21]. These changes must then be correlated with the degree of binding and the concentration of the free ligand.…”

Section: Introductionmentioning

confidence: 99%

“…In this communication, we describe thermodynamically rigorous analyses of spectroscopic approaches to study ligand - macromolecule interactions, including multiple-ligand binding phenomena, to obtain model-independent binding isotherms [1–6,8,17–21,31]. Our discussion focuses on the fundamental problem of obtaining thermodynamic and spectroscopic parameters free of assumptions about the relationship between the observed signal and the degree of ligand or macromolecule saturation.…”

Section: Introductionmentioning

confidence: 99%

“…Our discussion focuses on the fundamental problem of obtaining thermodynamic and spectroscopic parameters free of assumptions about the relationship between the observed signal and the degree of ligand or macromolecule saturation. We will address the quantitative analyses as applied to the use of the fluorescence intensity as the most often encountered spectroscopic technique in biochemical studies [1–6,8–10,13–15,18–21]. However, the described thermodynamic/spectroscopic relationships are general and applicable to any physico-chemical signal used to monitor the ligand - macromolecule interactions and proportional to the concentrations of different states of macromolecule or ligand (absorbance, fluorescence emission, fluorescence resonance energy transfer (FRET) efficiency, circular dichroism, NMR line width, or chemical shift, etc .…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Quantitative thermodynamic analyses of spectroscopic titration curves

Bujalowski

Jezewska

2014

Journal of Molecular Structure

Self Cite

View full text Add to dashboard Cite

Elucidation of ligand - macromolecule interactions requires detailed knowledge of energetics of the formed complexes. Spectroscopic methods are most commonly used in characterizing molecular interactions in solution. The methods do not require large quantities of material and most importantly, do not perturb the studied reactions. However, spectroscopic methods absolutely require the determination of the relationship between the observed signal and the degree of binding in order to obtain meaningful interaction parameters. In other words, the meaningful, thermodynamic interaction parameters can be only determined if the relationship between the observed signal and the degree of binding is determined and not assumed, based on an ad hoc model of the relationship. The approaches discussed here allow an experimenter to quantitatively determine the degree of binding and the free ligand concentration, i.e., they enable to construct thermodynamic binding isotherms in a model-independent fashion.

show abstract

Pyrosequencing‐based strategy for a successful SNP detection in two hypervariable regions: HV‐I/HV‐II of the human mitochondrial displacement loop

Anjum

Klein

et al. 2010

Electrophoresis

View full text Add to dashboard Cite

Forensic analysis of mitochondrial displacement loop (D-loop) sequences using Sanger sequencing or SNP detection by minisequencing is well established. Pyrosequencing has become an important alternative because it enables high-throughput analysis and the quantification of individual mitochondrial DNAs (mtDNAs) in samples originating from more than one individual. DNA typing of the mitochondrial D-loop region is usually the method of choice if STR analysis fails because of trace amounts of DNA and/or extensive degradation. The main aim of the present work was to optimize the efficiency of pyrosequencing. To do this, 31 SNPs within the hypervariable regions I and II of the D-loop of human mtDNA were simultaneously analyzed. As a novel approach, we applied two sets of amplification primers for the multiplexing assay. These went in combination with four sequencing primers for pyrosequencing. This method was compared with conventional sequencing of mtDNA from blood and biological trace materials.

show abstract

Interactions of the DNA Polymerase X of African Swine Fever Virus with Double-stranded DNA. Functional Structure of the Complex

Cited by 21 publications

References 63 publications

Full-length Dengue Virus RNA-dependent RNA Polymerase-RNA/DNA Complexes

Full-length Dengue Virus RNA-dependent RNA Polymerase-RNA/DNA Complexes

Quantitative thermodynamic analyses of spectroscopic titration curves

Pyrosequencing‐based strategy for a successful SNP detection in two hypervariable regions: HV‐I/HV‐II of the human mitochondrial displacement loop

Contact Info

Product

Resources

About