Interactions of the DNA Polymerase X from African Swine Fever Virus with Gapped DNA Substrates. Quantitative Analysis of Functional Structures of the Formed Complexes

Jezewska, Maria J.; Bujalowski, Paul J.; Bujalowski, Wlodzimierz

doi:10.1021/bi700677j

Cited by 25 publications

(59 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The advantage of using the etheno-derivatives of the ssDNA and ssRNA is that their fluorescence depends little upon the polarity of the environment and predominantly reflects the structure of the nucleic acid (23,60). The linear dependence of ⌬F obs over a large range of ⌺v i does not exclude the heterogeneous structure of the total binding site, as is the case of the African swine fever virus polymerase X (28,36). Nevertheless, it indicates that, similar to the African swine fever virus polymerase X, the full-length DENV polymerase forms a single type of complex with the polymer nucleic acid.…”

Section: Discussionmentioning

confidence: 99%

“…The dsRNA and dsDNA 30-mer were random sequence oligomers containing ϳ60% of GC base pairs with the sequence GGAGUCCACGACUUCGCAGGCUCGUUACGU, with T replacing U in the case of the DNA. The double-stranded conformations of the nucleic acids have been obtained by mixing oligomers with the complementary strands, heating the sample to 95°C, and slowly cooling for a period of ϳ4 h. The integrity of the dsRNA and dsDNA 30-mer has been tested using UV melting and analytical ultracentrifugation methods (27)(28)(29).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Full-length Dengue Virus RNA-dependent RNA Polymerase-RNA/DNA Complexes

Szymanski

Jezewska

Bujalowski

et al. 2011

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Fundamental aspects of interactions of the Dengue virus type 3 full-length polymerase with the single-stranded and doublestranded RNA and DNA have been quantitatively addressed. The polymerase exists as a monomer with an elongated shape in solution. In the absence of magnesium, the total site size of the polymerase-ssRNA complex is 26 ؎ 2 nucleotides. In the presence of Mg 2؉ , the site size increases to 29 ؎ 2 nucleotides, indicating that magnesium affects the enzyme global conformation. The enzyme shows a preference for the homopyrimidine ssRNAs. Positive cooperativity in the binding to homopurine ssRNAs indicates that the type of nucleic acid base dramatically affects the enzyme orientation in the complex. Both the intrinsic affinity and the cooperative interactions are accompanied by a net ion release. The polymerase binds the dsDNA with an affinity comparable with the ssRNAs affinity, indicating that the binding site has an open conformation in solution. The lack of detectable dsRNA or dsRNA-DNA hybrid affinities indicates that the entry to the binding site is specific for the sugar-phosphate backbone and/or conformation of the duplex. The dengue virus (DENV)2 is a member of the Flaviviridae family and the etiological agent of dengue fever, a disease affecting worldwide ϳ100 million people each year (1-5). The Flaviviridae family includes such human pathogens as tick-borne encephalitis virus, hepatitis C virus, West Nile virus, yellow fever virus, and Japanese encephalitis virus (1-5). The dengue virus exists in four distinct types, DENV1, -2, -3, and -4, which show ϳ60% genomic sequence identity (1). The dengue fever often develops into the dengue hemorrhagic fever, an acute form of the disease, possibly as a result of sequential infection with different types of the virus. It is characterized by a significant mortality, particularly for individuals with a weakened or undeveloped immune system. The small, 10.7-kbp positive strand RNA genome of the dengue virus encodes only 10 proteins: three structural proteins (capsid, premembrane, and envelope proteins) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5 proteins) (3, 6 -8). The entire viral genome is translated as a single polyprotein, subsequently cleaved by viral and cellular proteases into functional entities.The NS5 protein is the viral replicative RNA-dependent RNA polymerase (1, 3, 6 -8). The primary structure of the fulllength polymerase encompasses 900 amino acids (i.e. it is the largest of the nonstructural proteins of the dengue virus) (6 -10). The enzyme is built of two functional domains (6 -10). The N-terminal domain includes the first 263 amino acids. It functions as a methyltransferase (MTase), whose activity is necessary for viral RNA recognition by the host cell translational apparatus. Correspondingly, amino acids ϳ273-906 form the polymerase domain, containing the active site of the RNA synthesis (Fig. 1a) (6 -8). The crystal structures of the isolated N-terminal and polymerase domains have been determined up t...

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Full-length Dengue Virus RNA-dependent RNA Polymerase-RNA/DNA Complexes

Szymanski

Jezewska

Bujalowski

et al. 2011

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…Binding curves were fit by using KaleidaGraph software (Synergy Software, PA). In the case of titrations using competition with A(pA) 19 , the relative increase in the fluorescence of the nucleic acid (ΔF) upon binding of DENV NS5 is defined as ΔF obs ϭ (F i Ϫ F 0 )/F 0 , where F i is the fluorescence of the nucleic acid solution at a given titration point, i, and F 0 is the initial fluorescence of the sample (29,(37)(38)(39). In the case of direct titrations of fluorescein-modified SLA, the relative fluorescence change is defined as F i /F 0 .…”

Section: Methodsmentioning

confidence: 99%

“…In the case of direct titrations of fluorescein-modified SLA, the relative fluorescence change is defined as F i /F 0 . Both F 0 and F i are corrected for background fluorescence at the applied excitation wavelength (29,37,39). Standard B1 buffer, containing 50 mM Tris-HCl adjusted to pH 7.5 with HCl at a given temperature, 100 mM NaCl, 1 mM DTT, and 10% (wt/vol) glycerol, was used for all binding experiments.…”

Section: Methodsmentioning

confidence: 99%

Interactions between the Dengue Virus Polymerase NS5 and Stem-Loop A

Bujalowski

Choi

2017

J Virol

Self Cite

View full text Add to dashboard Cite

The process of RNA replication by dengue virus is still not completely understood despite the significant progress made in the last few years. Stem-loop A (SLA), a part of the viral 5= untranslated region (UTR), is critical for the initiation of dengue virus replication, but quantitative analysis of the interactions between the dengue virus polymerase NS5 and SLA in solution has not been performed. Here, we examine how solution conditions affect the size and shape of SLA and the formation of the NS5-SLA complex. We show that dengue virus NS5 binds SLA with a 1:1 stoichiometry and that the association reaction is primarily entropy driven. We also observe that the NS5-SLA interaction is influenced by the magnesium concentration in a complex manner. Binding is optimal with 1 mM MgCl 2 but decreases with both lower and higher magnesium concentrations. Additionally, data from a competition assay between SLA and single-stranded RNA (ssRNA) indicate that SLA competes with ssRNA for the same binding site on the NS5 polymerase. SLA 70 and SLA 80 , which contain the first 70 and 80 nucleotides (nt), respectively, bind NS5 with similar binding affinities. Dengue virus NS5 also binds SLAs from different serotypes, indicating that NS5 recognizes the overall shape of SLA as well as specific nucleotides.IMPORTANCE Dengue virus is an important human pathogen responsible for dengue hemorrhagic fever, whose global incidence has increased dramatically over the last several decades. Despite the clear medical importance of dengue virus infection, the mechanism of viral replication, a process commonly targeted by antiviral therapeutics, is not well understood. In particular, stem-loop A (SLA) and stem-loop B (SLB) located in the 5= untranslated region (UTR) are critical for binding the viral polymerase NS5 to initiate minus-strand RNA synthesis. However, little is known regarding the kinetic and thermodynamic parameters driving these interactions. Here, we quantitatively examine the energetics of intrinsic affinities, characterize the stoichiometry of the complex of NS5 and SLA, and determine how solution conditions such as magnesium and sodium concentrations and temperature influence NS5-SLA interactions in solution. Quantitatively characterizing dengue virus NS5-SLA interactions will facilitate the design and assessment of antiviral therapeutics that target this essential step of the dengue virus life cycle. KEYWORDS NS5, RNA polymerase, dengue virus, stem-loop A D engue virus (DENV) is a positive-sense, single-stranded RNA (ssRNA) virus and is a member of the Flavivirus genus within the Flaviviridae family. DENV causes a wide range of diseases in humans, ranging from self-limiting dengue fever to life-threatening dengue hemorrhagic fever and dengue shock syndrome (1-5). Recent estimates indicate that more than 300 million dengue virus infections occur each year, 96 million of which clinically manifest. Currently, it is estimated that 3.9 billion people living in 128 countries are at risk of infection by DENV (6, 7). Four ...

show abstract

“…ASFV encodes a homolog of the X family polymerases (pol X or pO174L), an AP endonuclease (pE296R), and a DNA ligase (pNP419L); however, no identifiable DNA glycosylase gene occurs in the ASFV genome (Yanez 1995). ASFV pol X is the smallest known nucleotide polymerase, sharing sequence similarity with the eukaryotic repair protein polymerase β (pol β) and certain functional and mechanistic similarities with pol β and other cellular polymerases (Bakhtina et al 2007;Jezewska et al 2007;Kumar et al 2007;Oliveros et al 1997;Yanez 1995). In vitro, pol X binds intermediates in the BER process, catalyzes template-dependent single nucleotide gap repair, and has AP lyase activity (Garcia-Escudero et al 2003;Oliveros et al 1997).…”

Section: Viral Dna Replicationmentioning

confidence: 99%

African Swine Fever Virus

Tulman

Delhon

et al. 2009

Current Topics in Microbiology and Immunology

131

117

View full text Add to dashboard Cite

African swine fever virus (ASFV) is a large, intracytoplasmicallyreplicating DNA arbovirus and the sole member of the family Asfarviridae . It is the etiologic agent of a highly lethal hemorrhagic disease of domestic swine and therefore extensively studied to elucidate the structures, genes, and mechanisms affecting viral replication in the host, virus-host interactions, and viral virulence. Increasingly apparent is the complexity with which ASFV replicates and interacts with the host cell during infection. ASFV encodes novel genes

show abstract

Interactions of the DNA Polymerase X from African Swine Fever Virus with Gapped DNA Substrates. Quantitative Analysis of Functional Structures of the Formed Complexes

Cited by 25 publications

References 54 publications

Full-length Dengue Virus RNA-dependent RNA Polymerase-RNA/DNA Complexes

Full-length Dengue Virus RNA-dependent RNA Polymerase-RNA/DNA Complexes

Interactions between the Dengue Virus Polymerase NS5 and Stem-Loop A

African Swine Fever Virus

Contact Info

Product

Resources

About