Interaction of Viruses with Cell Surface Receptors

Tardieu, Marc; Epstein, Rochelle L.; Weiner, Howard L.

doi:10.1016/s0074-7696(08)60366-6

Cited by 80 publications

(46 citation statements)

References 142 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…This idea was tested by using Northern blot analysis with a 0.7-kb fragment from porcine CD46 cDNA as a probe. This fragment, cloned by RT-PCR from PK15 cells, was labeled with 32 P and hybridized to poly(A) ϩ RNA from PK15, MDBK, and BHK cells. When low-stringency conditions were used for hybridization, RNA molecules corresponding to 3.8 and 3.6 kb were detected in bovine and porcine cells, respectively (Fig.…”

Section: Resultsmentioning

confidence: 99%

“…CD46 bov was unambiguously determined to be the 50-to 58-kDa and 80-to 90-kDa target proteins for these MAbs on the basis of the expression of CD46 bov cDNAs in heterologous cells. The identification of splice variants of the CD46 bov gene which lead to proteins with three different C termini (analogous to human Cyt 1, Cyt 2, and Cyt 3) and two A cellular receptor for a virus must fulfill two claims, namely, binding to virus and mediating virus invasion (32). To demonstrate the adsorption of BVDV to CD46 bov , a binding assay had to be established.…”

Section: Discussionmentioning

confidence: 99%

“…A 0.723-kb fragment from porcine CD46 was amplified from porcine RNA with oligonucleotides KM1 (5Ј-TTTGAATTCAA AATGATGGCGTTTTGCGCGCTGC) and KM5 (5Ј-ACATTTGACCACTTT ACACTC) by reverse transcription (RT)-PCR (derived from GenBank locus D70897.1; GI 1018988). This fragment served as a hybridization probe after labeling with 32 P by nick translation. This probe also was used to screen a bovine spleen cDNA library in lambda ZAPII (Stratagene).…”

Section: Cells and Viruses Mdbk Cells (Atcc CCLmentioning

confidence: 99%

See 2 more Smart Citations

CD46 Is a Cellular Receptor for Bovine Viral Diarrhea Virus

Maurer

Krey

Moennig

et al. 2004

J Virol

113

117

View full text Add to dashboard Cite

Section: Resultsmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Cells and Viruses Mdbk Cells (Atcc CCLmentioning

confidence: 99%

See 1 more Smart Citation

CD46 Is a Cellular Receptor for Bovine Viral Diarrhea Virus

Maurer

Krey

Moennig

et al. 2004

J Virol

113

117

View full text Add to dashboard Cite

“…We separated total binding, which is shown in Fig. 1, into nonspecific and specific components by fitting the total binding curve to a single-site binding isotherm based on the assumption that nonspecific binding is directly proportional to the ligand or virus concentration (nonspecific and specific binding curves are not shown) (30,48,51,52). Analysis of the specific component of binding revealed high affinity, saturable binding for AAV2 on COS and 293 cells (Table I).…”

Section: Receptor-mediated Binding Of Aav5-tomentioning

confidence: 99%

Binding of Adeno-associated Virus Type 5 to 2,3-Linked Sialic Acid Is Required for Gene Transfer

Walters

Keshavjee

et al. 2001

Journal of Biological Chemistry

316

223

View full text Add to dashboard Cite

Recombinant adeno-associated viruses (AAV) are promising gene therapy vectors. Whereas AAV serotype 2-mediated gene transfer to muscle has partially replaced factor IX deficiency in hemophilia patients, its ability to mediate gene transfer to the lungs for cystic fibrosis is hindered by lack of apical receptors. However, AAV serotype 5 infects human airway epithelia from the lumenal surface. We found that in contrast to AAV2, the apical membrane of airway epithelia contains abundant high affinity receptors for AAV5. Binding and gene transfer with AAV5 was abolished by genetic or enzymatic removal of sialic acid from the cell surface. Furthermore, binding and gene transfer to airway epithelia was competed by lectins that specifically bind 2,3-linked sialic acid. These observations suggest that 2,3-linked sialic acid is either a receptor for AAV5 or it is a necessary component of a receptor complex. Further elucidation of the receptor for this virus should enhance understanding of parvovirus biology and expand the therapeutic targets for AAV vectors.

show abstract

“…[25][26][27] This concept has been exemplified in studies which demonstrate that purified quantities of fiber can inhibit viral attachment to cell surfaces 28 and that attachment can also be inhibited by anti-fiber antibodies. 29 Viruses used in all of the previously described trials are respiratory viruses with fiber proteins that are specific for receptors located on epithelia of the lung and other respiratory tissues.…”

Section: Introductionmentioning

confidence: 99%

In vitro and in vivo asessment of adenovirus 41 as a vector for gene delivery to the intestine

et al. 1998

View full text Add to dashboard Cite

In order to identify suitable adenoviral vectors for efficient tiated enterocytes, probable targets for oral gene delivery delivery of transgenic proteins and peptides to the intesbut rather resistant to adenovirus-mediated gene transfer, tine, the ability of adenovirus types 5 and 41 (an enter-28.4% of the population internalized the Ad 5 vector and otropic serotype) to bind to and enter undifferentiated and less than 10% bound the virus. Adenovirus 41 was differentiated enterocytes was assessed. FACS analysis efficiently internalized in differentiated enterocytes as showed no significant difference between the virions in 89.6% of the cellular population took up the virus while their ability to bind to undifferentiated Caco-2 cells as 37.4% bound the virus. These results were consistent with 81.6% of the cellular population bound adenovirus 5 (Ad 5) those observed in vivo in rat jejunum. Thus, molecularly and 79.8% bound Ad 41. Both virions were also efficiently engineered Ad 41-based recombinants could be highly internalized in this cell type as 99.6% of the cells took up efficient vectors for delivery of transgenic proteins to differAd 5, while 95.9% took up Ad 41. In studies with differenentiated enterocytes.

show abstract

Interaction of Viruses with Cell Surface Receptors

Cited by 80 publications

References 142 publications

CD46 Is a Cellular Receptor for Bovine Viral Diarrhea Virus

CD46 Is a Cellular Receptor for Bovine Viral Diarrhea Virus

Binding of Adeno-associated Virus Type 5 to 2,3-Linked Sialic Acid Is Required for Gene Transfer

In vitro and in vivo asessment of adenovirus 41 as a vector for gene delivery to the intestine

Contact Info

Product

Resources

About