Interaction of minor groove ligands to an AAATT/AATTT site: correlation of thermodynamic characterization and solution structure

Abstract

A combination of circular dichroism spectroscopy, titration calorimetry, and optical melting has been used to investigate the association of the minor groove ligands netropsin and distamycin to the central A3T2 binding site of the DNA duplex d(CGCAAATTGGC).d(GCCAATTTGCG). For the complex with netropsin at 20 degrees C, a ligand/duplex stoichiometry of 1:1 was obtained with Kb approximately 4.3 x 10(7) M-1, delta Hb approximately -7.5 kcal mol-1, delta Sb approximately 9.3 cal K-1 mol-1, and delta Cp approximately 0. Previous NMR studies characterized the distamycin complex with A3T2 at saturation as a dimeric side-by-side complex. Consistent with this result, we found a ligand/duplex stoichiometry of 2:1. In the current study, the relative thermodynamic contributions of the two distamycin ligands in the formation of this side-by-side complex (2:1 Dst.A3T2) were evaluated and compared with the thermodynamic characteristics of netropsin binding. The association of the first distamycin molecule of the 2:1 Dst.A3T2 complex yielded the following thermodynamic profile: Kb approximately 3.1 x 10(7) M-1, delta Hb = -12.3 kcal mol-1, delta Sb = -8 cal K-1 mol-1, and delta Cp = -42 cal K-1 mol-1. The binding of the second distamycin molecule occurs with a lower Kb of approximately 3.3 x 10(6) M-1, a more favorable delta Hb of -18.8 kcal mol-1, a more unfavorable delta Sb of -34 cal K-1 mol-1, and a higher delta Cp of -196 cal K-1 mol-1. The latter term indicates an ordering of electrostricted and structural water molecules by the complexes. These results correlate well with the NMR titrations and are discussed in context of the solution structure of the 2:1 Dst.A3T2 complex.

Energetic Diversity of DNA Minor-groove Recognition by Small Molecules Displayed Through Some Model Ligand-DNA Systems

“…Such behavior is somewhat surprising since the 5 0 -AAAAA-3 0 sites, when unoccupied, are known to accommodate only one DST molecule and only after such 1 : 1 binding is completed the accommodation of the second DST molecule can take place. 33,34 Moreover, binding affinity of a single DST molecule for the 5 0 -AAAAA-3 0 site is significantly lower than the corresponding affinity of a single NET molecule (Table 1). 43 Our results suggest that NET molecules bound to the 5 0 -AAAAA-3 0 sites locally widen their minor grooves to such extent that upon titrating with DST the high affinity 2 : 1 binding of DST that prevails over the 1 : 1 binding of NET becomes possible.…”

“…[27][28][29][30] As shown recently, some of the sites that contain five successive AT base-pairs or one GC and four AT base-pairs can accommodate simultaneously two DST molecules. [31][32][33][34][35] In such 2 : 1 complexes the bound DST molecules are stacked in a head to tail orientation with the charged groups located at the opposite ends of the complex. By contrast, dicationic NET cannot form this kind of a side-by-side arrangement due to the electrostatic repulsion between its charged ends.…”

Binding of netropsin to several DNA constructs: Evidence for at least two different 1:1 complexes formed from an –AATT-containing ds-DNA construct and a single minor groove binding ligand

“…The model hairpin DNA used in the previous study was a 20-mer having an (A 2 T 2 ) 2 netropsin binding site and a complete sequence of 5′-d(CGAATTCGTCTCCGAATTCG)-3′. Calorimetric titration experiments performed previously using netropsin and other minor groove binding ligands have shown similar complexity in the enthalpy data indicative of more than one binding process in play [24,[42][43][44]. To date, no one has offered an explanation for the presence of multiple binding processes in the 1:1 interaction of minor groove binding ligands to -AT-rich sequences in DNA.…”

Assessing the sequence specificity in the binding of Co(III) to DNA via a thermodynamic approach

“…The changes in the T m values for COTAR2 and COTAR3 are similar to what would be observed bound species, such as Co(III), to a DNA oligomer alters the enthalpic contribution to the duplex stabilfor intrastrand and interstrand cross-linking by cisity. 40 The alteration may, for example, lead to stabiplatin, respectively. 41 It has been demonstrated that lization arising from the resultant favorable electrocisplatin preferentially cross-links DNA in an intrastatic interaction or destabilization arising from hestrand fashion at GG sites and, to a lesser extent, lix distortion at the point of coordination.…”