Interacting with Hemoglobin: Paracoccidioides spp. Recruits hsp30 on Its Cell Surface for Enhanced Ability to Use This Iron Source

Abstract

Paracoccidioides spp. are thermally dimorphic fungi that cause paracoccidioidomycosis and can affect both immunocompetent and immunocompromised individuals. The infection can lead to moderate or severe illness and death. Paracoccidioides spp. undergo micronutrients deprivation within the host, including iron. To overcome such cellular stress, this genus of fungi responds in multiple ways, such as the utilization of hemoglobin. A glycosylphosphatidylinositol (GPI)-anchored fungal receptor, Rbt5, has the primary role of acquiring the essential nutrient iron from hemoglobin. Conversely, it is not clear if additional proteins participate in the process of using hemoglobin by the fungus. Therefore, in order to investigate changes in the proteomic level of P. lutzii cell wall, we deprived the fungus of iron and then treated those cells with hemoglobin. Deprived iron cells were used as control. Next, we performed cell wall fractionation and the obtained proteins were submitted to nanoUPLC-MSE. Protein expression levels of the cell wall F1 fraction of cells exposed to hemoglobin were compared with the protein expression of the cell wall F1 fraction of iron-deprived cells. Our results showed that P. lutzii exposure to hemoglobin increased the level of adhesins expression by the fungus, according to the proteomic data. We confirmed that the exposure of the fungus to hemoglobin increased its ability to adhere to macrophages by flow cytometry. In addition, we found that HSP30 of P. lutzii is a novel hemoglobin-binding protein and a possible heme oxygenase. In order to investigate the importance of HSP30 in the Paracoccidioides genus, we developed a Paracoccidioides brasiliensis knockdown strain of HSP30 via Agrobacterium tumefaciens-mediated transformation and demonstrated that silencing this gene decreases the ability of P. brasiliensis to use hemoglobin as a nutrient source. Additional studies are needed to establish HSP30 as a virulence factor, which can support the development of new therapeutic and/or diagnostic approaches.

Paracoccidioides lutzii Formamidase Contributes to Fungal Survival in Macrophages

“…Since formamidase has been associated with virulence determinants and nitrogen metabolism in the Paracoccidioides species, we silenced the Plfmd gene through antisense RNA technology associated with ATMT to elucidate its biological role in P. lutzii . This technique has contributed to the identification of proteins required for relevant processes of P. brasiliensis pathobiology, such as Cdc42 [ 46 ], HSP90 [ 47 ], Rbt5 [ 48 ], Ccp [ 24 ], PCN [ 49 ], SidA [ 37 ], FglA [ 50 ] and HSP30 [ 31 ].…”

“…The P. lutzii formamidase gene ( fmd ) was silenced through the antisense RNA (aRNA) technique along with ATMT technology, as described previously [ 24 , 30 , 31 ]. Briefly, the oligonucleotides F (5′ CCGCTCGAGCGGCTTGCATAACCGCTGGCATC 3′) and R (5′ GGCGCGCCTCGTCGGCGGAATCGTTATT 3′) were designed to generate an antisense fragment (123 bp) of the P. lutzii fmd gene (PAAG_03333; Accession number obtained in the FungiDB database at , accessed on 19 July 2022).…”

Heme Oxygenase/Carbon Monoxide Participates in the Regulation of Ganoderma lucidum Heat-Stress Response, Ganoderic Acid Biosynthesis, and Cell-Wall Integrity

“…The chitin and glucan contents increased by 97% and 73%, respectively, which may explain the reduced sensitivity of HMX1 silenced strains to cell-wall stress. A recent study showed that HSP30, which was a possible HO in the Paracoccidioides genus and could be recruited on the cell surface, was important for P. brasiliensis to use host hemoglobin as an iron source [ 12 ]. These studies all suggest that HO/CO has an important role in regulating cell-wall components and functions.…”

“…It was also found that TaMSRA4.1, one of the members of the methionine sulfoxide reductase (MSR) gene family, could interact with HO-1 during the response to salinity and drought stress in wheat [ 11 ]. In research on Paracoccidioides spp., HSP30 was considered a possible HO recruited to the cell surface to participate in the deprivation of nutrients from the host [ 12 ]. Two HO candidates were identified in the fungus Alternaria alternata .…”