Integrating conventional microscopy and molecular analysis to analyse the abundance and distribution of four Calanus congeners in the North Atlantic

Mapping the spawning grounds of North Sea cod ( Gadus morhua ) by direct and indirect means

“…Despite advances in DNA bar coding, robotics, high-speed sequencing and DNA chips, molecular methods should be viewed as a valuable addition to traditional taxonomic skills, rather than a replacement (Hebert et al 2003). Combining visual microscopy with molecular analysis of subsamples is likely to remain the only practicable approach for large-scale applications in marine plankton studies for the foreseeable future (Lindeque et al 2006).…”

Penetration of Pacific zooplankton into the western Arctic Ocean tracked with molecular population genetics

“…DNA was extracted by incubating individual zooplankters in 100 µl of 10% Chelex-100 (Bio-Rad), 0.2% SDS and 0.4 mg Proteinase K ml -1 for 2 h at 55°C, then at 95°C for 15 min. A segment of the mitochondrial 16S rRNA gene was amplified and sequenced with the primers 16sarRNA (5' CGCCTGTTTAACAAAAACAT 3') (Palumbi & Benzie 1991) and 16sb2rRNA (5' ATT CAACATCGAGGTCACAAAC 3') (Lindeque et al 2005). Sequencing was carried out with an Applied Biosystems 3700 sequencer.…”

Distribution of overwintering <i>Calanus</i> in the North Norwegian Sea

“…Counting was performed to stage specific abundance of Calanus finmarchicus, C. hyperboreus and C. glacialis in addition to one group containing other copepod taxa. C. finmarchicus and C. glacialis was distinguished based on prosome length, even though this method might be unreliable in some cases (Lindeque et al, 2006). Quantitative species composition within the group of other copepods was not examined further.…”