Integrated approach for the molecular characterization of edited plants obtained via Agrobacterium tumefaciens-mediated gene transfer

Abstract

Agrobacterium tumefaciens-mediated gene transfer—actually the most used method to engineer plants—may lead to integration of multiple copies of T-DNA in the plant genome, as well as to chimeric tissues composed of modified cells and wild type cells. A molecular characterization of the transformed lines is thus a good practice to select the best ones for further investigation. Nowadays, several quantitative and semi-quantitative techniques are available to estimate the copy number (CN) of the T-DNA in genetically modified plants. In this study, we compared three methods based on (1) real-time polymerase chain reaction (qPCR), (2) droplet digital PCR (ddPCR), and (3) next generation sequencing (NGS), to carry out a molecular characterization of grapevine edited lines. These lines contain a knock-out mutation, obtained via CRISPR/Cas9 technology, in genes involved in plant susceptibility to two important mildew diseases of grapevine. According to our results, qPCR and ddPCR outputs are largely in agreement in terms of accuracy, especially for low CN values, while ddPCR resulted more precise than qPCR. With regard to the NGS analysis, the CNs detected with this method were often not consistent with those calculated by qPCR and ddPCR, and NGS was not able to discriminate the integration points in three out of ten lines. Nevertheless, the NGS method can positively identify T-DNA truncations or the presence of tandem/inverted repeats, providing distinct and relevant information about the transgene integration asset. Moreover, the expression analysis of Cas9 and single guide RNA (sgRNA), and the sequencing of the target site added new information to be related to CN data. This work, by reporting a practical case-study on grapevine edited lines, explores pros and cons of the most advanced diagnostic techniques available for the precocious selection of the proper transgenic material. The results may be of interest both to scientists developing new transgenic lines, and to laboratories in charge of GMO control.

VvEPFL9-1 Knock-Out via CRISPR/Cas9 Reduces Stomatal Density in Grapevine

“…2 The sequence of the guide RNA carried by the vector was designed with CRISPR-P 2.0 software 3 and recognizes a region of 20 bp in the third exon of VvEPFL9-1 (GCACATACAATGAATGCAAA, on-score = 0.7058). Agrobacterium tumefaciens (A.t.)-mediated gene transfer was performed on embryogenic calli of ‘Sugraone’ according to Dalla Costa et al (2022) . NPTII was used as selectable marker to confer resistance to kanamycin.…”