Insulin as a Potent Stimulator of Akt, ERK and Inhibin-βE Signaling in Osteoblast-Like UMR-106 Cells

Abstract

Insulin is a peptide hormone of the endocrine pancreas and exerts a wide variety of physiological actions in insulin sensitive tissues, such as regulation of glucose homeostasis, cell growth, differentiation, learning and memory. However, the role of insulin in osteoblast cells remains to be fully characterized. In this study, we demonstrated that the insulin (100 nM) has the ability to stimulate the phosphorylation of protein kinase B (Akt/PKB) and extracellular signal-regulated kinase (ERK) and the levels of inhibin-βE in the osteoblast-like UMR-106 cells. This insulin-stimulated activities were abolished by the PI3K and MEK1 inhibitors LY294002 and PD98059, respectively. This is the first report proving that insulin is a potential candidate that enables the actions of inhibin-βE subunit of the TGF-β family. The current investigation provides a foundation for the realization of insulin as a potential stimulator in survival signaling pathways in osteoblast-like UMR-106 cells.

TGF‐β1 induces amoeboid‐to‐mesenchymal transition of CD44high oral squamous cell carcinoma cells via miR‐422a downregulation through ERK activation and Cofilin‐1 phosphorylation

“…The PCR protocol was as follows: initial denaturation at 95°C for 10 minutes followed by 40 cycles of 95°C for 30 seconds, 57°C for 30 seconds and 72°C for 30 seconds. The following PCR primer sets were used: Cofilin‐1 :5′‐GCCGCTATGCCCTCTA‐3′ (sense), 5′‐CAATTCATGCTTGATCCCT‐3′ (antisense) 12 ; Vimentin : 5′‐CCCTCACCTGTGAAGTGGAT‐3′ (sense), 5′‐GACGAGCCATTTCCTCCTTC‐3′ (antisense) 7 ; N‐cadherin : 5′‐GCCCCTCAAGTGTTACCTCAA‐3′ (sense), 5′‐AGCCGAGTGATGGTCCAATTT‐3′ (antisense) 13 ; Snail : 5′‐CAAGGAATACCTCAGCCTGG‐3′ (sense), 5′‐CATCTGAGTGGGTCTGGAGG‐3′ (antisense) 11 ; E‐cadherin : 5′‐GAACGCATTGCCACATACAC‐3′ (sense), 5′‐AGCACCTTCCATGACAGACC‐3′ (antisense) 7 ; ERK1 : 5′‐CGCTTCCGCCATGAGAATGTC‐3′ (sense), 5′‐CAGGTCAGTCTCCATCAGGTCCTG‐3′ (antisense) 14 ; ERK2 : 5′‐GAAGACACAGCACCTCAGCAA‐3′ (sense), 5′‐TGGAAGGCTTGAGGTCACGGT‐3′ (antisense) 15 ; GAPDH : 5′‐GTGAACCATGAGAAGTATGACAAC‐3′ (sense), 5′‐ATGAGTCCTTCCACGATACC‐3′ (antisense), 7 miR‐422a: 5′‐ GCTCCCATGCTATTAATATTCCTGGA −3′ (sense), 5′‐ CGATCGCGCTTCAGCTCA −3′ (antisense), 16 U6: 5′‐ GCTTCGGCAGCACATATACTAAAAT −3′ (sense), 5′‐ CGCTTCACGAATTTGCGTGTCAT −3′ (antisense) 17 . GAPDH was used as an internal control to normalize target gene expression.…”

1α,25-Dihydroxyvitamin D3 ameliorates diabetes-induced bone loss by attenuating FoxO1-mediated autophagy

“…But other growth factors present in serum such as cytokines might also be involved in this process. Previous studies have explored the role of insulin using osteoblast-like cells incubated in the absence of serum and confirmed that insulin was responsible for stimulating PI3K/Akt signaling cascade ( 44 , 45 ). Thus, elevated serum insulin level mediated by 1,25D in vivo study might be an explanation for the activation of PI3K/Akt signaling by 1,25D in hyperglycemia environment.…”

A Neuroprotective Bovine Colostrum Attenuates Apoptosis in Dexamethasone-Treated MC3T3-E1 Osteoblastic Cells

“…An analysis of cell cycle distribution in PDGF-treated osteoblasts using flow cytometry has revealed that PDGF treatment increased the number of cells in the S phase and decreased the cell numbers in the G0/G1 phase, indicating that PDGF promoted cell entry into the S phase in osteoblasts and inhibited cell apoptosis [ 52 ] being both ERK1 and ERK2 signaling pathways activated by PDGF [ 53 ]. Moreover, the ERK pathway has shown to be upregulated in response to insulin treatment in osteoblast-like cells providing that this growth factor is a potent stimulator in survival signaling pathways in insulin-sensitive cells [ 54 ].…”