Inhibition of NF-κB Signaling Reduces Virus Load and Gammaherpesvirus-Induced Pulmonary Fibrosis

Abstract

Idiopathic pulmonary fibrosis (IPF) is a chronic progressive lung disorder of unknown etiology. Several studies have demonstrated an association between pulmonary infection with a herpesvirus and IPF. Based on those observations, we have developed a mouse model in which interferon (IFN)␥R؊/؊ mice infected intranasally with murine gammaherpesvirus 68 (MHV68) develop lung fibrosis. We hypothesize that viral load was a critical factor for the development of fibrosis. Because nuclear factor (NF)-B signaling is required to efficiently establish gammaherpesvirus, latency we infected IFN␥R Idiopathic pulmonary fibrosis (IPF) is a destructive lung disease of unknown cause, with no proven effective therapy other than lung transplantation.1 Although the cellular and molecular pathways that drive the pathogenesis of IPF are complex and not fully delineated, increasing evidence suggests that a key event in its pathogenesis is ongoing alveolar epithelial injury in association with an abnormal host repair response. Several studies have implicated viral infections as an important factor in IPF pathogenesis. Specifically, Epstein-Barr virus (EBV) DNA and protein have been detected in 40 to 70% of lung tissue of IPF patients, compared with 10 to 17% of lung controls.2-7 Our group has detected viral DNA for EBV, Kaposi's sarcoma-associated herpesvirus (KSHV), and Cytomegalovirus herpesvirus in Ͼ95% of lung samples of IPF patients, with statically higher frequency compared with patients with non-IPF lung diseases. 5 We have developed a model of chronic herpesvirusinduced pulmonary fibrosis infection using the herpesvirus murine gammaherpesvirus 68 (MHV68), a natural pathogen of wild murid rodents that has strong genetic and biological similarities with the human gammaherpesviruses EBV and KSHV. 8 -10 In immunocompetent animals, intranasal infection with MHV68 leads to an acute phase of lytic replication in the lung. Within several weeks, infectious virus is undetectable, and latent virus

High-mobility group box 1 accelerates lipopolysaccharide-induced lung fibroblast proliferation in vitro: involvement of the NF-κB signaling pathway

“…Furthermore, the TLR4 protein, whose expression was also regulated by these treatments, has been associated previously with the development and progression of pulmonary fibrosis. 37,38 The presently observed changes in MMP-2, MMP-9, and TIMP-2 further confirm the importance of the NF-κB pathway in mediating the effects of LPS and HMGB1 on lung fibroblast proliferation.…”

PINK1 deficiency impairs mitochondrial homeostasis and promotes lung fibrosis

“…A549 ER stress and potential second hit leading to the development of lung fibrosis in the setting of a vulnerable AECII), as previously described (11,31,(35)(36)(37)(38)(39). First, we demonstrated evident mitochondrial dysfunction in Pink1 +/-and Pink1 -/-mice after virus challenge, as shown by decreased activity of both complex I (mean reduction, 16% and 50%, respectively) and complex IV (mean reduction, 52% and 73%, respectively) ( Figure 10A).…”

“…PINK1-deficient mice were maintained as a heterozygous line and bred to generate Pink1 Purification of DNA was performed in spleen samples using DNeasy kits (QIAGEN) to determine viral load. Quantitative PCR (qPCR) for MHV68 DNA was performed in spleen samples as described previously (38), using viral ORF50 primers (forward, GGC-CGCAGACATTTAATGAC; reverse, GCCTCAACTTCTCTGGATAT-GCC) and host GAPDH as housekeeping gene (forward, CCTGCAC-CACCAACTGCTTAG; reverse, GTGGATGCAGGGATGATGTTC). To quantify the mtDNA/gDNA ratio, qPCR was used to amplify 1 gene of the mitochondrial genome (Nd2 in mouse; mt16S in humans) and 1 gene of the nuclear genome (Gapdh in mouse; B2M in humans).…”

Role of Endoplasmic Reticulum Stress in Age-Related Susceptibility to Lung Fibrosis

“…We have shown that gherpesvirus infection causes persistent virus infection, injury of lung epithelial cells, and pulmonary fibrosis in IFN-gR 2/2 mice with similar features to the human disease. Progressive fibrosis was not found in virus-infected wild-type mice (8)(9)(10)(11)(12)(13).…”

“…Real-time RT-PCR was performed using SYBR Green and primers specific for the genes of interest and normalized using 18S RNA and RPL19 genes. Quantitative PCR for MHV68 DNA was performed as described previously (13) using open reading frame (ORF) 50 primers and glyceraldehyde 3-phosphate dehydrogenase as housekeeping gene.…”