Inhibition of H1N1 influenza virus by selenium nanoparticles loaded with zanamivir through p38 and JNK signaling pathways

Lin, Zhengfang; Li, Yinghua; Guo, Min; Xiao, Misi; Wang, Changbing; Zhao, Mingqi; Xu, Tiantian; Xia, Yu; Zhu, Bing

doi:10.1039/c7ra06477b

Cited by 61 publications

(46 citation statements)

References 52 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…More recently, SeNPs have been instead biosynthesized from Actinobacteria showing good stability and capacity to inhibit Dengue virus in vitro . 120 Moreover, SeNPs were used to carry different antiviral drugs including zanamivir, 121 oseltamivir, 122 amantadine, 123 and ribavirin. 119 Their functionalization with the desired drug can be easily achieved adding the molecule during their synthesis through the Se ion controlled reduction.…”

Section: Antiviral Activity Inside Host Cellsmentioning

confidence: 99%

Hard Nanomaterials in Time of Viral Pandemics

et al. 2020

View full text Add to dashboard Cite

The SARS-Cov-2 pandemic has spread worldwide during 2020, setting up an uncertain start of this decade. The measures to contain infection taken by many governments have been extremely severe by imposing home lockdown and industrial production shutdown, making this the biggest crisis since the second world war. Additionally, the continuous colonization of wild natural lands may touch unknown virus reservoirs, causing the spread of epidemics. Apart from SARS-Cov-2, the recent history has seen the spread of several viral pandemics such as H2N2 and H3N3 flu, HIV, and SARS, while MERS and Ebola viruses are considered still in a prepandemic phase. Hard nanomaterials (HNMs) have been recently used as antimicrobial agents, potentially being next-generation drugs to fight viral infections. HNMs can block infection at early (disinfection, entrance inhibition) and middle (inside the host cells) stages and are also able to mitigate the immune response. This review is focused on the application of HNMs as antiviral agents. In particular, mechanisms of actions, biological outputs, and limitations for each HNM will be systematically presented and analyzed from a material chemistry point-of-view. The antiviral activity will be discussed in the context of the different pandemic viruses. We acknowledge that HNM antiviral research is still at its early stage, however, we believe that this field will rapidly blossom in the next period.

show abstract

Section: Antiviral Activity Inside Host Cellsmentioning

confidence: 99%

Hard Nanomaterials in Time of Viral Pandemics

et al. 2020

View full text Add to dashboard Cite

show abstract

“…Primers were as follows: H1N1 forward primer 5′ CTCAGCAAATCCTACATTA 3′ and reverse primer 5′ TAGTAGATGGATGGTGAAT 3′. Sequence of the probe was CCATAGCACGAGGACTTCTT, 31 GAPDH forward primer 5′ CGCCAAGAAGGTGATCATTTC 3′, and reverse primer 5′ CAGGAGGCGTTCGAGATGAC 3′.…”

Section: Viral Proliferationmentioning

confidence: 99%

Restriction of H1N1 influenza virus infection by selenium nanoparticles loaded with ribavirin via resisting caspase-3 apoptotic pathway

Lin¹,

Li²,

Gong³

et al. 2018

IJN

Self Cite

View full text Add to dashboard Cite

IntroductionRibavirin (RBV) is a broad-spectrum antiviral drug. Selenium nanoparticles (SeNPs) attract much attention in the biomedical field and are used as carriers of drugs in current research studies. In this study, SeNPs were decorated by RBV, and the novel nanoparticle system was well characterized. Madin-Darby Canine Kidney cells were infected with H1N1 influenza virus before treatment with RBV, SeNPs, and SeNPs loaded with RBV (Se@RBV).Methods and resultsMTT assay showed that Se@RBV nanoparticles protect cells during H1N1 infection in vitro. Se@RBV depressed virus titer in the culture supernatant. Intracellular localization detection revealed that Se@RBV accumulated in lysosome and escaped to cytoplasm as time elapsed. Furthermore, activation of caspase-3 was resisted by Se@RBV. Expressions of proteins related to caspase-3, including cleaved poly-ADP-ribose polymerase, caspase-8, and Bax, were downregulated evidently after treatment with Se@RBV compared with the untreated infection group. In addition, phosphorylations of phosphorylated 38 (p38), JNK, and phosphorylated 53 (p53) were inhibited as well. In vivo experiments indicated that Se@RBV was found to prevent lung injury in H1N1-infected mice through hematoxylin and eosin staining. Tunel test of lung tissues present that DNA damage reached a high level but reduced substantially when treated with Se@RBV. Immunohistochemical test revealed an identical result with the in vitro experiment that activations of caspase-3 and proteins on the apoptosis pathway were restrained by Se@RBV treatment.ConclusionTaken together, this study elaborates that Se@RBV is a novel promising agent against H1N1 influenza virus infection.

show abstract

“…[23][24][25][26][27][28] For example, the nanosheet structure of graphene oxide was shown to be important for its antiviral properties against pseudorabies virus (PRV) and PEDV; 29 bioprotective nanobrous membranes (RNMs) were reported to have high bactericidal and viricidal efficacy. 30 However, the majority of currently reported antiviral nanomaterials exist in a spherical form, 31,32 suggesting the possibility to enhance the functional properties of nanomaterials through reasonable and effective control of their morphology.…”

Section: Introductionmentioning

confidence: 99%

High antiviral activity of mercaptoethane sulfonate functionalized Te/BSA nanostars against arterivirus and coronavirus

et al. 2020

View full text Add to dashboard Cite

show abstract

Inhibition of H1N1 influenza virus by selenium nanoparticles loaded with zanamivir through p38 and JNK signaling pathways

Abstract: Zanamivir is an effective drug for influenza virus infection, but strong molecular polarity and aqueous solubility limit its clinical application.

Cited by 61 publications

References 52 publications

Hard Nanomaterials in Time of Viral Pandemics

Hard Nanomaterials in Time of Viral Pandemics

Restriction of H1N1 influenza virus infection by selenium nanoparticles loaded with ribavirin via resisting caspase-3 apoptotic pathway

High antiviral activity of mercaptoethane sulfonate functionalized Te/BSA nanostars against arterivirus and coronavirus

Contact Info

Product

Resources

About