Inhibition of glucose transport into brain by phlorizin, phloretin and glucose analogues

Betz, A. Lorris; Drewes, Lester R.; Gilboe, David D.

doi:10.1016/0005-2736(75)90028-0

Cited by 68 publications

(14 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Phloretin was subsequently found to block sugar uptake in intestinal tissue [51], drawing significant interest to its application in the treatment of diabetes. Phloretin was shown to specifically inhibit GLUT2 and to a lesser extent SGLT1 [22,52]. Here, we show that phloretin inhibits the transport of GLUT2 between the apical and basal membranes in both directions.…”

Section: Discussionsupporting

confidence: 54%

See 1 more Smart Citation

Live imaging of GLUT2 glucose-dependent trafficking and its inhibition in polarized epithelial cysts

et al. 2014

View full text Add to dashboard Cite

GLUT2 is a facilitative glucose transporter, expressed in polarized epithelial cells of the liver, intestine, kidney and pancreas, where it plays a critical role in glucose homeostasis. Together with SGLT1/2, it mediates glucose absorption in metabolic epithelial tissues, where it can be translocated apically upon high glucose exposure. To track the subcellular localization and dynamics of GLUT2, we created an mCherry–hGLUT2 fusion protein and expressed it in multicellular kidney cysts, a major site of glucose reabsorption. Live imaging of GLUT2 enabled us to avoid the artefactual localization of GLUT2 in fixed cells and to confirm the apical GLUT2 model. Live cell imaging showed a rapid 15 ± 3 min PKC-dependent basal-to-apical translocation of GLUT2 in response to glucose stimulation and a fourfold slower basolateral translocation under starvation. These results mark the physiological importance of responding quickly to rising glucose levels. Importantly, we show that phloretin, an apple polyphenol, inhibits GLUT2 translocation in both directions, suggesting that it exerts its effect by PKC inhibition. Subcellular localization studies demonstrated that GLUT2 is endocytosed through a caveolae-dependent mechanism, and that it is at least partly recovered in Rab11A-positive recycling endosome. Our work illuminates GLUT2 dynamics, providing a platform for drug development for diabetes and hyperglycaemia.

show abstract

Section: Discussionsupporting

confidence: 54%

“…It is thought that phloretin exerts its effect by binding to GLUT2 and SGLT1 rsob.royalsocietypublishing.org Open Biol. 4: 140091 [22,23]. However, other work showed phloretin inhibits PKC [24], suggesting it might directly affect GLUT2 translocation.…”

Section: Phloretin Blocks Both Basal and Apical Glut2 Translocationmentioning

confidence: 99%

Live imaging of GLUT2 glucose-dependent trafficking and its inhibition in polarized epithelial cysts

et al. 2014

View full text Add to dashboard Cite

show abstract

“…3 , n =6), supporting the conclusion that enhanced PMO uptake was mediated by saturable active transport of GF rather than by osmotic effects. Finally, intramuscular co-administration of PMO-GF with phloretin, an inhibitor of glucose and fructose transporters 20 , abolished the potentiating effect of GF on PMO activity ( Fig. 3h,i ).…”

Section: Resultsmentioning

confidence: 88%

“…Cy5-labelled 2′OMe and siRNA were purchased from TriLink BioTechnologies (San Diego, CA, USA) and Eurogentec (LIEGE Science Park, Belgium), respectively. Both PMO (5′- ggccaaacctcggcttacctgaaat -3′) and 2′OMe AO (5′- ggccaaacctcggcttacct -3′) sequences were targeted to the murine dystrophin exon23/intron23 boundary site as reported 7 20 . Glyceraldehyde 3-phosphate dehydrogenase siRNAs used were sense 5′- CAGAAGACUGU GGAUGGCC -3′ (DTDT) and antisense 5′- GGCCAUCCACAGUCUUCUG -3′ (DGDG) 11 .…”

Section: Methodsmentioning

confidence: 99%

Hexose enhances oligonucleotide delivery and exon skipping in dystrophin-deficient mdx mice

Hou

Cao

et al. 2016

Nat Commun

View full text Add to dashboard Cite

Carbohydrate-based infusion solutions are widely used in the clinic. Here we show that co-administration of phosphorodiamidate morpholino oligomers (PMOs) with glucose enhances exon-skipping activity in Duchenne muscular dystrophy (DMD) mdx mice. We identify a glucose–fructose (GF) formulation that potentiates PMO activity, completely corrects aberrant Dmd transcripts, restores dystrophin levels in skeletal muscles and achieves functional rescue without detectable toxicity. This activity is attributed to enhancement of GF-mediated PMO uptake in the muscle. We demonstrate that PMO cellular uptake is energy dependent, and that ATP from GF metabolism contributes to enhanced cellular uptake of PMO in the muscle. Collectively, we show that GF potentiates PMO activity by replenishing cellular energy stores under energy-deficient conditions in mdx mice. Our findings provide mechanistic insight into hexose-mediated oligonucleotide delivery and have important implications for the development of DMD exon-skipping therapy.

show abstract

“…3 ) is in line with reports for other reactive carbonyl species. In terms of pharmacological applicability it should be noted that phloretin inhibits glucose uptake into brain and brain endothelial cells in vitro [49] and in vivo [50,51] .…”

Section: Discussionmentioning

confidence: 99%

Covalent adduct formation between the plasmalogen-derived modification product 2-chlorohexadecanal and phloretin

Üllen

Nusshold

Glasnov

et al. 2015

Biochemical Pharmacology

View full text Add to dashboard Cite

show abstract

Inhibition of glucose transport into brain by phlorizin, phloretin and glucose analogues

Cited by 68 publications

References 23 publications

Live imaging of GLUT2 glucose-dependent trafficking and its inhibition in polarized epithelial cysts

Live imaging of GLUT2 glucose-dependent trafficking and its inhibition in polarized epithelial cysts

Hexose enhances oligonucleotide delivery and exon skipping in dystrophin-deficient mdx mice

Covalent adduct formation between the plasmalogen-derived modification product 2-chlorohexadecanal and phloretin

Contact Info

Product

Resources

About