Inhibition of Fibronectin Matrix Assembly by the Heparin-binding Domain of Vitronectin

Abstract

The deposition of fibronectin into the extracellular matrix is an integrin-dependent, multistep process that is tightly regulated in order to ensure controlled matrix deposition. Reduced fibronectin deposition has been associated with altered embryonic development, tumor cell invasion, and abnormal wound repair. In one of the initial steps of fibronectin matrix assembly, the aminoterminal region of fibronectin binds to cell surface receptors, termed matrix assembly sites. The present study was undertaken to investigate the role of extracellular signals in the regulation of fibronectin deposition. Our data indicate that the interaction of cells with the extracellular glycoprotein, vitronectin, specifically inhibits matrix assembly site expression and fibronectin deposition. The region of vitronectin responsible for the inhibition of fibronectin deposition was localized to the heparin-binding domain. Vitronectin's heparin-binding domain inhibited both ␤ 1 and non-␤ 1 integrin-dependent matrix assembly site expression and could be overcome by treatment of cells with lysophosphatidic acid, an agent that promotes actin polymerization. The interaction of cells with the heparin-binding domain of vitronectin resulted in changes in actin microfilament organization and the subcellular distribution of the actin-associated proteins ␣-actinin and talin. These data suggest a mechanism whereby the heparin-binding domain of vitronectin regulates the deposition of fibronectin into the extracellular matrix through alterations in the organization of the actin cytoskeleton.The deposition of fibronectin into the extracellular matrix is a dynamic, multistep process that is normally tightly regulated in order to ensure controlled matrix deposition. In certain disease states, including pulmonary fibrosis and atherosclerosis, loss of this regulation gives rise to either excess or inappropriate fibronectin deposition (1). In addition, reduced fibronectin deposition has been associated with altered embryonic development, tumor cell invasion, and abnormal wound repair (1). The mechanisms that control the rate and extent of fibronectin deposition are only partially understood.Adherent cells polymerize an insoluble fibronectin matrix by assembling cell-or plasma-derived soluble fibronectin into insoluble fibrils (2). In one of the initial steps of matrix assembly, cell surfaces bind the amino-terminal region of fibronectin in a reversible and saturable manner (3, 4). Subsequent homophilic binding interactions are thought to promote the polymerization of the fibronectin molecule into an insoluble matrix (5-9) and allow for the regeneration of the cell surface amino-terminal binding site (2). The binding of the amino terminus of fibronectin to cell surface receptors, termed matrix assembly sites (3), is mediated by the first five type I repeats of fibronectin (4, 10). The molecule(s) that mediates the binding of the amino terminus of fibronectin to cell surfaces has not been definitively identified. It has been proposed that the III 1 module o...

Vitronectin's Basic Domain is a Syndecan Ligand which Functionsin transto Regulate Vitronectin Turnover

“…Syndecan-2 binds to fibronectin and regulates actin organization and fibronectin matrix assembly (38,41). In earlier studies, we have shown that the heparin binding domain of vitronectin modulates actin organization and inhibits the polymerization of the fibronectin matrix by fibroblast cells (30). Whether the effect of vitronectin on fibronectin matrix deposition is mediated through cell surface heparan sulfate proteoglycans is not known.…”

“…Generation of wild-type recombinant vitronectin DNA (rVn) and rVnRGE, which contains the point mutation D47E (Figure 1), have been previously described (30). The recombinant vitronectin DNA mutant rVn 347-358, which incorporates a deletion of residues K347-G358 (Figure 1) and the addition of six histidines to the carboxy-terminus was generated via recombinant PCR mutagenesis by utilizing the following primers: (1) 5 -CCAGCACCAGC CCAGTCAGG-3 (sense); (2) 5 -CCTTGACC TACCGGTCACAACGAGGC-3 (sense); (3) 5 -GTGACCGGTAGGTCAAGGAGGGGCGGG-3 (anti-sense); (4) 5 GGGTCTAGACTAGTGAT GGTGATGGTGATGCAGATGGCCAGGAGCTG G-3 (anti-sense).…”

“…The glutathione S-transferase (GST) fusion protein GST-VnHBD ( Figure 1) was generated as previously described (30). The fusion protein GST-VnHBD 347-358 ( Figure 1) was generated by PCR using rVn 347-358 (above) as a template together with the following primers: CCCGGATCCGCACCCCGCCCCTCCTTG (sense) and CCCGAATTCCTAGGCGCGGGATG GCCGGCG (anti-sense).…”

“…Viral stocks and conditioned medium containing recombinant proteins were generated as previously described (30).…”

“…The pGEX-2T containing the insert VnHBD 347-358 was transfected into BL21 bacteria for expression (Amersham Pharmacia) using standard procedures. GST-fusion proteins were purified from bacterial lysates with glutathione agarose (Sigma), as previously described (30).…”