Inhibition of cytosolic and mitochondrial creatine kinase by siRNA in HaCaT- and HeLaS3-cells affects cell viability and mitochondrial morphology

Abstract

The creatine kinase (CK) system is essential for cellular energetics in tissues or cells with high and fluctuating energy requirements. Creatine itself is known to protect cells from stress-induced injury. By using an siRNA approach to silence the CK isoenzymes in human keratinocyte HaCaT cells, expressing low levels of cytoplasmic CK and high levels of mitochondrial CK, as well as HeLa cancer cells, expressing high levels of cytoplasmic CK and low levels of mitochondrial CK, we successfully lowered the respective CK expression levels and studied the effects of either abolishing cytosolic brain-type BB-CK or ubiquitous mitochondrial uMi-CK in these cells. In both cell lines, targeting the dominant CK isoform by the respective siRNAs had the strongest effect on overall CK activity. However, irrespective of the expression level in both cell lines, inhibition of the mitochondrial CK isoform generally caused the strongest decline in cell viability and cell proliferation. These findings are congruent with electron microscopic data showing substantial alteration of mitochondrial morphology as well as mitochondrial membrane topology after targeting uMi-CK in both cell lines. Only for the rate of apoptosis, it was the least expressed CK present in each of the cell lines whose inhibition led to the highest proportion of apoptotic cells, i.e., downregulation of uMi-CK in case of HeLaS3 and BB-CK in case of HaCaT cells. We conclude from these data that a major phenotype is linked to reduction of mitochondrial CK alone or in combination with cytosolic CK, and that this effect is independent of the relative expression levels of Mi-CK in the cell type considered. The mitochondrial CK isoform appears to play the most crucial role in maintaining cell viability by stabilizing contact sites between inner and outer mitochondrial membranes and maintaining local metabolite channeling, thus avoiding transition pore opening which eventually results in activation of caspase cell-death pathways.

ASB9 interacts with ubiquitous mitochondrial creatine kinase and inhibits mitochondrial function

“…Moreover, under situations of a compromised cellular energy state, such as ischaemia, oxidative stress, and calcium overload, MtCK seems to be a susceptible target for oxidation; compensatory upregulation of MtCK gene expression has also been reported [18,19]. In addition, the downregulation of uMtCK by small interfering RNA (siRNA) in HaCaT and HeLaS3 cells reportedly affects cell viability and mitochondrial morphology [34]. Therefore, the targeting of ASB9 to uMtCK is quite proper for efficient regulation of cell growth.…”

High ubiquitous mitochondrial creatine kinase expression in hepatocellular carcinoma denotes a poor prognosis with highly malignant potential

“…Cells were transfected with the human uMtCK‐specific 23/27mer RNA duplex or a universal negative control duplex at 20 nM, respectively, according to the vender instructions (Integrated DNA Technologies, IA). The human uMtCK‐specific RNA duplex used was 5′‐UGAAGCACACCACGGAUCU‐3′ and 3′‐ACUUCGUGUGGUGCCUAGA‐5′, negative control RNA duplex, 5′‐CGUUAAUCGCGUAUAAUACGCGUAT‐3′ and 3′‐CAGCAAUUAGCGCAUAUUAUGCGCAUA‐5′ (Integrated DNA Technologies). The transfection was performed using Lipofectamine Plus™ (Invitrogen) as described …”

Role of Creatine Kinase – Hexokinase Complex in the Migration of Adenine Nucleotides in Mitochondrial Dysfunction

“…Increasing of the duration of ischemia to 18 hours was followed by an increase in the octamer ratio (53%). Published data suggest that octameric mitochondrial creatine kinase contributes to the appearance and strengthening of contact sites, which increases the efficiency of energy formation in brain mitochondria, consolidates the membrane structure, and determines the resistance of membranes to the adverse effect of hypoxia (Gross, Wallimann, 1995;Koufen et al, 1999;Lenz et al, 2007;Meyer et al, 2006). The existence of two oligomeric forms of this enzyme probably maintains the near-equilibrium state of reaction in a wide range of physiological conditions.…”