Inhibition of Anopheles gambiae Odorant Receptor Function by Mosquito Repellents

Abstract

Background:The mode of action of insect repellents on odorant receptor (OR) function remains unclear. Results: Anopheles gambiae OR function in vitro is inhibited by specific repellents. Conclusion: The identified inhibitory effects are due to functional blocking of Orco, the common subunit of OR heteromers. Significance: The specific mechanism of action is distinct from the proposed modes of DEET function.

Positive Allosteric Modulation of Insect Olfactory Receptor Function by ORco Agonists

“…Working dilutions were freshly prepared immediately before use in modified Ringer buffer (190 mM KCl, 25 mM NaCl, 3 mM CaCl 2 , 3 mM MgCl 2 , 20 mM Hepes, 22.5 mM glucose, pH 6.5), which reflects more closely the composition of sensillum lymph (Kaissling and Thorson, 1980; Grünert and Gnatzy, 1987; Olsson and Hansson, 2013). Relative to the previously used Ringer buffer at pH 7.2 (Tsitoura et al, 2015), this buffer yielded much higher responses, with considerably higher signal-to noise ratios and retention of specificity, without adverse effects on cell viability (Supplementary Figure S1). …”

“…The expression of A. gambiae ORs in lepidopteran insect cells and their functional characterization by luminescence assays have been previously reported (Tsitoura et al, 2010, 2015). Briefly, Hi5 cells were transfected with pEIA.ORx, ORco and Photina at per weight ratios (essentially molar ratios as well) of 1:1:2, or with pEIA.ORco and Photina or pEIA.ORx and Photina at 1:1.…”

“…The construction and use of pEIA.OR1, pEIA.OR2, pEIA.OR9, pEIA.ORco, and pEIA.Photina have been previously reported (Tsitoura et al, 2010; Tsitoura et al, 2015). The PCR amplification of the complete OR53 open reading frame (ORF) from antennal cDNA preparations, obtained as previously described (Iatrou and Biessmann, 2008), was carried out using forward and reverse primers OR53-FA/C [GAAT GGATCC CACC ATG AAGTTACTAGAGCTAGACAAC] and OR53-RA/N [GATA GGATCC TTA GAATACATTTTTTAGCACCAAG], respectively, ( Bam HI restriction sites are in italics, initiation codon is in bold and termination codon is underlined).…”

“…In some experiments that required comparisons of absolute values (i.e., magnitude of responses) between different heteromers and the ORco homomer, normalization for differences in transfection efficiencies and cell numbers was performed by permeabilizing cells with Triton X-100 detergent (up to 0.15%), or by measuring intracellular Ca 2+ -release responses in cells co-expressing a delta opioid receptor together with Gα16, following administration of its ligand DPDPE as previously described (Tsitoura et al, 2015). In such case, cells expressing ORco homomers or ORco/ORx heteromers were challenged sequentially with OA and TX100 in a separate series of wells, in order to avoid artifacts from desensitization and responses were calculated as ratios of OR response/TX100-evoked increase in luminescence.…”

The insect repellent N,N-diethyl-m-toluamide (DEET) induces angiogenesis via allosteric modulation of the M3 muscarinic receptor in endothelial cells

“…Potential mechanisms are inhibition of acetylcholinesterase (AChE)8, modulation of muscarinic receptors49 or the well-conserved ionotropic receptor Ir40a, odorant receptors (OR) and gustatory receptors (GR)75051525354. Among these targets, it has been reported that some inhibitors of human AChE, like donepezil, rivastigmine or galantamine have pro-angiogenic properties in in vitro HUVEC cultured on ECMgel like in chick chorioallantoic membrane and/or in an ischemic hind limb model1455.…”