Infection of Cultured Immature Dendritic Cells with Human Immunodeficiency Virus Type 1

Häusser, G; Hultgren, Catharina; Akagawa, Kiyoko S.; Tsunetsugu-Yokota, Yasuko; Meyerhans, Andreas

doi:10.1007/978-1-4615-1971-3_107

Cited by 3 publications

(3 citation statements)

References 6 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…However, there has been some controversy as to the susceptibility of DCs to HIV-1 infection and IFN-␣ production by DCs. Some studies have presented negative data on productive HIV-1 infection of DCs (18,30). Likewise, it has not been settled which subset of DCs or other cell type in PBMC respond to HIV-1 with IFN-␣ production (13,14).…”

Section: Discussionmentioning

confidence: 99%

“…Total RNA was isolated from purified IPCs or CD11c ϩ DCs by using an RNeasy mini kit (Qiagen, Hilden, Germany). Reverse transcription (RT) was performed with oligo(dT) primer, pd(T) [12][13][14][15][16][17][18] (Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, United Kingdom). cDNA was amplified by PCR using the following primers: CXCR4 forward (GATGACAGATATATCT GTGACCGC) and CXCR4 reverse (TTAGCTGGAGTGAAAACTTGAAG A); CCR5 forward (ATGGTCATCTGCTACTCGGGAATC) and CCR5 reverse (TCACAAGCCCACAGATATTTCCTG); and DC-SIGN forward (TGT CCCTGGGAATGGACATTC) and DC-SIGN reverse (GGCTGGAGAAAGA AACTGTTC).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Natural Alpha Interferon-Producing Cells Respond to Human Immunodeficiency Virus Type 1 with Alpha Interferon Production and Maturation into Dendritic Cells

Yonezawa

Morita

Takaori‐Kondo

et al. 2003

J Virol

102

View full text Add to dashboard Cite

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Natural Alpha Interferon-Producing Cells Respond to Human Immunodeficiency Virus Type 1 with Alpha Interferon Production and Maturation into Dendritic Cells

Yonezawa

Morita

Takaori‐Kondo

et al. 2003

J Virol

102

View full text Add to dashboard Cite

show abstract

“…MDDCs are obtained from peripheral blood monocytes by treatment with cytokines such as GM-CSF and IL-4 [81]. MDDCs are commonly used as an in vitro model for immature dermal DCs either in skin or mucosae [82].…”

Section: Monocyte-derived Dendritic Cells (Mddcs)mentioning

confidence: 99%

The influence of cytokines, chemokines and their receptors on HIV‐1 replication in monocytes and macrophages

Kedzierska

Crowe

Turville

et al. 2002

Reviews in Medical Virology

165

100

View full text Add to dashboard Cite

Monocytes, macrophages and dendritic cells play an important role in the initial infection and contribute to its pathogenesis throughout the course of infection. Myeloid cells express CD4 and chemokine receptors known for HIV-1 fusion and entry. The beta-chemokine receptor, CCR5, is the major co-receptor in conjunction with CD4 for macrophage (M)-tropic or (R5) isolates of HIV-1, whereas the alpha-chemokine receptor, CXCR4, facilitates entry of T-tropic or (X4) HIV-1 strains. Cells of myeloid lineage may be infected predominantly with R5- strains, although infection with dual-tropic isolates of HIV-1 (exhibiting the capacity to use CCR-5 and/or CXCR-4 for entry) or some strains of X4- isolates has also been reported. The expression of chemokine receptors, HIV-1 infection and replication is under continuous regulation by a complex cytokine network produced by a variety of cells. The effects of cytokines/chemokines on HIV-1 replication in cells of myeloid lineage can be inhibitory (IFN-alpha, IFN-beta, IFN-gamma, GM-CSF, IL-10, IL-13 and IL-16 and beta-chemokines), stimulatory (M-CSF, TNF-alpha, TNF-beta, IL-1, IL-6) or bifunction al, that is both inhibitory and stimulatory (IL-4). This review focuses on the overall expression of chemokine receptors on cells of myeloid lineage and considers the mechanisms of entry of R5-, X4- and dual-tropic strains of HIV-1 into these cells. The effects of cytokines/chemokines on viral entry and productive HIV-1 infection are also reviewed.

show abstract

Nonlymphoid reservoirs of HIV replication in children with chronic-progressive disease

Brodie

2000

Journal of Leukocyte Biology

View full text Add to dashboard Cite

Autopsy tissues from 2 cohorts of age-matched HIV-infected children with similar plasma viral load (>105 HIV RNA copies/ml), but with distinct AIDS-associated disease manifestations, were examined for sites of persistent HIV replication. One group consisted of 3 children with severe lymphoid atrophy and peripheral blood CD4+ T cell counts of <10/mm3. Another group was composed of 6 children with extensive hyperplasia of mucosal-associated lymphoid tissues and blood CD4+ T cell counts >500/mm3. Hyperplastic bronchiole- and gut-associated lymphoid tissues were characterized by extensive networks of germinal center follicular dendritic cells (FDC) containing large amounts of immune-complexed virion RNA. Conversely, pulmonary and gastrointestinal tissues from children with severe CD4+ T cell depletion were devoid of any secondary lymphoid structures, yet these tissues also harbored high concentrations of HIV RNA. Dual in situ procedures showed that only macrophage (Mφ) within these sites contained tat fusion transcripts, a product of post-transcriptional splicing and a correlate of productive infection. When examining explant cultures of Mφ and FDC, only Mφ harbored HIV tat mRNA and only Mφ demonstrated budding retroviral particles. Hence, germinal center FDC in secondary lymphoid tissues are key reservoirs of immune-complexed HIV RNA and are likely to contribute to AIDS-associated lymphoproliferations; however, these cells do not support HIV replication, and failure to do so results from a post-transcriptional block in the virus life cycle. Moreover, gut and pulmonary Mφ represent a lineage of cells that are permissive to HIV replication and contribute significantly to the high viral load in children with severe CD4+ T cell depletion. It will be important to identify the molecular mechanisms that allow for these highly productive infections of Mφ.

show abstract

Infection of Cultured Immature Dendritic Cells with Human Immunodeficiency Virus Type 1

Cited by 3 publications

References 6 publications

Natural Alpha Interferon-Producing Cells Respond to Human Immunodeficiency Virus Type 1 with Alpha Interferon Production and Maturation into Dendritic Cells

Natural Alpha Interferon-Producing Cells Respond to Human Immunodeficiency Virus Type 1 with Alpha Interferon Production and Maturation into Dendritic Cells

The influence of cytokines, chemokines and their receptors on HIV‐1 replication in monocytes and macrophages

Nonlymphoid reservoirs of HIV replication in children with chronic-progressive disease

Contact Info

Product

Resources

About