Induction of Osteogenic Protein-1 Expression by Interleukin-1.BETA. in Cultured Rabbit Articular Chondrocytes.

Abstract

To elucidate the effects of interleukin-1beta (IL-1beta) on osteogenic protein-1 (OP-1) gene expression in a polylayer culture of rabbit articular chondrocytes, we measured rabbit OP-1 mRNA using quantitative TaqMan reverse transcriptase-polymerase chain reaction (RT-PCR) techniques. Rabbit articular chondrocytes were isolated and cultured in minimum essential medium eagle alpha modification containing 10% fetal bovine serum for 7 days. IL-1beta was then added and cultures were continued for 48 or 96 hours. OP-1 gene expression was detected in cell cultures both with and without addition of IL-1beta. However, the level of expression was very low in the control group. OP-1 gene expression was significantly increased about 450- to 800-fold in IL-1beta-treated groups (0.1, 1, and 10 ng/ml) versus the control group. Evaluation of serial changes in OP-1 expression after addition of IL-1beta (10 ng/ml) revealed that OP-1 gene expression increased rapidly after addition of IL-1beta, reaching a peak at 48 hours, and then decreasing. Simultaneous assay of CD44 expression demonstrated a rapid increase, similar to that of OP-1 expression, following addition of IL-1beta: this was followed by a more gradual increase. Assay of hyaluronan synthase-2 (HAS-2) expression following addition of IL-1beta showed an increase after OP-1 expression had already reached a peak. Our results demonstrate that OP-1 expression is induced by IL-1beta and suggest that this expression, like that of HAS-2, may play a role as a protective mechanism against inflammatory cytokines.

Effect of interleukin‐1β on osteogenic protein 1–induced signaling in adult human articular chondrocytes

“…To avoid the effect of growth factors present in the serum and to identify responses induced solely by IL‐1β and OP‐1, we selected serum‐free cultures. Although IL‐1β up‐regulated expression of endogenous BMP‐2 and OP‐1 in human cartilage in this study and in previous studies (28, 29) and in rabbit cartilage (34), IL‐1β had no stimulatory effect on the gene expression of the BMP and OP‐1 receptors. In contrast, it caused a decrease in the number of ALK‐2 and ALK‐3 receptors on the chondrocyte surface, whereas ALK‐6 appeared to be a constitutively expressed kinase that is not affected by IL‐1β or degenerative processes (35).…”

Modulating macrophage activities to promote endogenous bone regeneration: Biological mechanisms and engineering approaches

“… M1-like Mediator (3.2); Instructor (3.3). [ [85] , [86] , [87] ] IL-4 Cytokine belongs to interleukins. • Inhibiting osteoclast formation from macrophages; • Attenuating the inflammatory level elevated by the excessive infiltration of M1-like macrophages; • Overturning TNF-α-involved osteocyte apoptosis progression.…”

“…Inhibition of IL-1beta signalling with IL-1 receptor antagonist suppresses tissue growth and bone formation in rabbit models [ 86 ]. Furthermore, two different groups reported that IL-1beta could even stimulate in vitro cultured cartilage explants to express osteogenic protein-1 (OP-1) – an osteogenic marker, revealing a strong osteotropic function of IL-1beta in tissue development [ 87 ].…”

Evaluation of rabbit auricular chondrocyte isolation and growth parameters in cell culture

“…Aggrecan: forward: CCGCTGTGAGGTGATGCA, reverse: CGTGGAGATGGCCCGATA, probe: ACACAACACCTTTCACCACG (Entrez nucleotide accession number: L38480; gi: 1220470). Sequences for the GAPDH primer set have been previously described (Yoshida et al, 2002): forward: CAACGTGTCGGTCGTGGA, reverse: ACCACCTTCTTGATGTC GTCATAC, probe: TGACCTGCCGCCTGGAGAAAGCTGCTAA.…”