Induction of intestinal stemness and tumorigenicity by aberrant internalization of commensal non-pathogenic E. coli

Sahu, Upasana; Choudhury, Arnab; Parvez, Suhel; Biswas, Subhrajit; Kar, Sudeshna

doi:10.1038/cddis.2017.27

Cited by 26 publications

(16 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The absolute quantification of ZIKV RNA was described previously. The forward (F) and reverse (R) primer sequences for ZIKV, MLK3, IL-6, IL-8, TNF-␣, MCP-1, and ␤-actin are as follows (6,(39)(40)(41)(42)(43)(44): ZIKV, F, GGTCAGCGTCCTCTCTAATAAACG, and R, GCACCCTAGTGTCCA CTTTTTCC; MLK3, F, GCAGCCCATTGAGAGTGAC, and R, CACTGCCCTTAGAGAAGGTGG; IL-6, F, ATGAACT CCTTCTCCACAAGCGC, and R, GAAGAGCCCTCAGGCTGGACTG; IL-8, F, ATGACTTCCAAGCTGGCCGTGGCT, and R, TCTCAGCCCTCTTCAAAAACTTCTC; TNF-␣, F, CGGTGCTTGTTCCTCAGC, and R, GCCAGAGGGCTGAT TAGAGA; MCP-1, F, CATTGTGGCCAAGGAGATCTG, and R, CTTCGGAGTTTGGGTTTGCTT; and ␤-actin, F, CCAACCGCGAGAAGATGA, and R, CCAGAGGCGTACAGGGATAG. Real-time quantification of mRNAs was performed by using a QuantiFast SYBR green RT-PCR kit (Qiagen, Düsseldorf, Germany).…”

Section: Constructs and Stable Cell Line Generationmentioning

confidence: 99%

High-Throughput Screening Identifies Mixed-Lineage Kinase 3 as a Key Host Regulatory Factor in Zika Virus Infection

Cheng

Chi

et al. 2019

J Virol

View full text Add to dashboard Cite

The Zika virus (ZIKV) life cycle involves multiple steps and requires interactions with host factors. However, the inability to systematically identify host regulatory factors for ZIKV has hampered antiviral development and our understanding of pathogenicity. Here, using a bioactive compound library with 2,659 small molecules, we applied a high-throughput and imaging-based screen to identify host factors that modulate ZIKV infection. The screen yielded hundreds of hits that markedly inhibited or potentiated ZIKV infection in SNB-19 glioblastoma cells. Among the hits, URMC-099, a mixed-lineage kinase 3 (MLK3) inhibitor, significantly facilitated ZIKV replication in both SNB-19 cells and the neonatal mouse brain. Using gene silencing and overexpression, we further confirmed that MLK3 was a host restriction factor against ZIKV. Mechanistically, MLK3 negatively regulated ZIKV replication through induction of the inflammatory cytokines interleukin-6 (IL-6), IL-8, tumor necrosis factor alpha (TNF-α), and monocyte chemoattractant protein 1 (MCP-1) but did not modulate host interferon-related pathways. Importantly, ZIKV activated the MLK3/MKK7/Jun N-terminal protein kinase (JNK) pathway in both SNB-19 cells and neonatal mouse brain. Together, these findings reveal a critical role for MLK3 in regulating ZIKV infection and facilitate the development of anti-ZIKV therapeutics by providing a number of screening hits. IMPORTANCE Zika fever, an infectious disease caused by the Zika virus (ZIKV), normally results in mild symptoms. Severe infection can cause Guillain-Barré syndrome in adults and birth defects, including microcephaly, in newborns. Although ZIKV was first identified in Uganda in 1947 in rhesus monkeys, a widespread epidemic of ZIKV infection in South and Central America in 2015 and 2016 raised major concerns. To date, there is no vaccine or specific medicine for ZIKV. The significance of our research is the systematic discovery of small molecule candidates that modulate ZIKV infection, which will allow the development of antiviral therapeutics. In addition, we identified MLK3, a key mediator of host signaling pathways that can be activated during ZIKV infection and limits virus replication by inducing multiple inflammatory cytokines. These findings broaden our understanding of ZIKV pathogenesis.

show abstract

Section: Constructs and Stable Cell Line Generationmentioning

confidence: 99%

High-Throughput Screening Identifies Mixed-Lineage Kinase 3 as a Key Host Regulatory Factor in Zika Virus Infection

Cheng

Chi

et al. 2019

J Virol

View full text Add to dashboard Cite

show abstract

“…In a latest study, Sahu et al linked the dysbiotic behavior of a constitutively invasive variant of commensal non-pathogenic E. coli to CRC tumorigenesis ( 155 ). Aberrant host invasion leads to realignment of multiple host signal transduction cascades through reciprocal modulation of microbe sensing pathways Nod1/Rip2 and TLR/MyD88, leading to an expansion of the cancer stem cell population.…”

Section: Bacterial Signaling Mechanisms In Crcmentioning

confidence: 99%

Bacterial Signaling at the Intestinal Epithelial Interface in Inflammation and Cancer

Coleman

Haller

2018

Front. Immunol.

View full text Add to dashboard Cite

The gastrointestinal (GI) tract provides a compartmentalized interface with an enormous repertoire of immune and metabolic activities, where the multicellular structure of the mucosa has acquired mechanisms to sense luminal factors, such as nutrients, microbes, and a variety of host-derived and microbial metabolites. The GI tract is colonized by a complex ecosystem of microorganisms, which have developed a highly coevolved relationship with the host’s cellular and immune system. Intestinal epithelial pattern recognition receptors (PRRs) substantially contribute to tissue homeostasis and immune surveillance. The role of bacteria-derived signals in intestinal epithelial homeostasis and repair has been addressed in mouse models deficient in PRRs and signaling adaptors. While critical for host physiology and the fortification of barrier function, the intestinal microbiota poses a considerable health challenge. Accumulating evidence indicates that dysbiosis is associated with the pathogenesis of numerous GI tract diseases, including inflammatory bowel diseases (IBD) and colorectal cancer (CRC). Aberrant signal integration at the epithelial cell level contributes to such diseases. An increased understanding of bacterial-specific structure recognition and signaling mechanisms at the intestinal epithelial interface is of great importance in the translation to future treatment strategies. In this review, we summarize the growing understanding of the regulation and function of the intestinal epithelial barrier, and discuss microbial signaling in the dynamic host–microbe mutualism in both health and disease.

show abstract

“…These effects were achieved through the TLR7/IKK/NF-κB/IL-6 signaling pathway ( 73 ). Commensal E. coli has been identified as a major protagonist of microbe-induced colorectal oncogenesis ( 74 ). In a previous study, repression of the microbe sensing pathway TLR/MyD88 with simultaneous activation of the nucleotide-binding oligomerization domain-containing protein 1/receptor-interacting protein 2 (Nod1/Rip2) pathway was responsible for the acquisition of stem-like properties in bacteria-infected intestinal cancer cells, which resulted in expansion of a tumorigenic CSC population marked by enhanced malignancy traits, long term self-renewal capacity and robust tumorigenic ability ( 74 ).…”

Section: Relationship Between Tlrs and Lung Cancermentioning

confidence: 99%

“…Commensal E. coli has been identified as a major protagonist of microbe-induced colorectal oncogenesis ( 74 ). In a previous study, repression of the microbe sensing pathway TLR/MyD88 with simultaneous activation of the nucleotide-binding oligomerization domain-containing protein 1/receptor-interacting protein 2 (Nod1/Rip2) pathway was responsible for the acquisition of stem-like properties in bacteria-infected intestinal cancer cells, which resulted in expansion of a tumorigenic CSC population marked by enhanced malignancy traits, long term self-renewal capacity and robust tumorigenic ability ( 74 ). Similarly, Alvarado et al ( 75 ) reported that glioblastoma CSCs downregulated TLR4 to evade immune suppression, and that activation of downstream TLR signaling pathways may reduce tumor growth and disrupt CSC self-renewal by repressing the expression of the transcription factor retinoblastoma binding protein 5 (RBBP5) ( 76 ).…”

Section: Relationship Between Tlrs and Lung Cancermentioning

confidence: 99%

Roles of toll-like receptors: From inflammation to lung cancer progression (Review)

Liu

Xie

et al. 2017

biom rep

View full text Add to dashboard Cite

Lung cancer is among the most common malignant tumors worldwide, and is characterized by a low survival rate compared with other cancers. Toll-like receptors (TLRs) are highly conserved in evolution and widely expressed on immune cells, where they serve an important role in the innate immune system by evoking inflammatory responses. Evasion of immune destruction is an important hallmark in the development of cancer. There is an established association between chronic inflammation and cancer, with TLRs serving important roles in the immune response against tumor cells. Recently, TLRs have been identified on tumor cells, where their activation may orchestrate the downstream signaling pathways that serve crucial functions in tumorigenesis and tumor progression. The present review summarizes the roles of TLRs as sensors on lung cancer cells that regulate lung cancer progression with regard to cell growth and invasion, angiogenesis and cancer stem cell behavior. This aimed to provide theoretical support for the development of therapies that target TLR signaling pathways for the treatment of lung cancer.

show abstract

Induction of intestinal stemness and tumorigenicity by aberrant internalization of commensal non-pathogenic E. coli

Cited by 26 publications

References 43 publications

High-Throughput Screening Identifies Mixed-Lineage Kinase 3 as a Key Host Regulatory Factor in Zika Virus Infection

High-Throughput Screening Identifies Mixed-Lineage Kinase 3 as a Key Host Regulatory Factor in Zika Virus Infection

Bacterial Signaling at the Intestinal Epithelial Interface in Inflammation and Cancer

Roles of toll-like receptors: From inflammation to lung cancer progression (Review)

Contact Info

Product

Resources

About