Inducing respiratory complex I impairment elicits an increase in PGC1α in ovarian cancer

Abstract

Anticancer strategies aimed at inhibiting Complex I of the mitochondrial respiratory chain are increasingly being attempted in solid tumors, as functional oxidative phosphorylation is vital for cancer cells. Using ovarian cancer as a model, we show that a compensatory response to an energy crisis induced by Complex I genetic ablation or pharmacological inhibition is an increase in the mitochondrial biogenesis master regulator PGC1α, a pleiotropic coactivator of transcription regulating diverse biological processes within the cell. We associate this compensatory response to the increase in PGC1α target gene expression, setting the basis for the comprehension of the molecular pathways triggered by Complex I inhibition that may need attention as drawbacks before these approaches are implemented in ovarian cancer care.

Ovarian Cancer: A Landscape of Mitochondria with Emphasis on Mitochondrial Dynamics

“…PGC-1α is a co-transcriptional regulation factor that induces mitochondrial biogenesis by activating different transcription factors, including NRF-1 and NRF-2, which promote the expression of TFAM which drives transcription and replication of mtDNA [ 62 ]. An increase of PGC-1α and TFAM expression proteins has been found in ovarian cancer cells and tissues [ 21 , 59 ], which is consistent with the increase of mtDNA content and mitochondrial number [ 21 , 56 ]. The same tissues showed an increased level of prohibitin proteins [ 21 ].…”

“…However, in the same samples a decrease of complex I activity has been reported despite the increase of mitochondrial biogenesis [ 21 ]. Additionally, in an ovarian cancer cell model, the induction of respiratory complex I impairment by genetic ablation or inhibitors elicits an increase in PGC-1α expression associated with increase of ROS production [ 59 ]. In this case the authors attributed the increase expression of PGC-1α to the enhanced cellular ROS level [ 59 ].…”

NDUFS3 knockout cancer cells and molecular docking reveal specificity and mode of action of anti-cancer respiratory complex I inhibitors

“…Human colorectal cancer cell line HCT116 was authenticated using AMPFISTRIdentifiler kit (Applied Biosystem #4322288) and its STR profile corresponded to the putative background. Mitochondrial DNA (mtDNA) was sequenced by Sanger sequencing as previously described [ 45 ], to ensure wild-type genotype. The results are available upon request.…”

“…The results are available upon request. NDUFS3 knockout cells, referred as SKOV3 −/− , HCT116 −/− and B16-F10 −/− , were generated by genome editing as previously reported [ 7 , 45 , 46 ]. Briefly, CRISPR/Cas9 system was used to introduce a frameshift mutation in NDUFS3 gene in SKOV3 human cell line and Ndufs3 gene in B16-F10 murine cell line, using exon 2 targeting guide TGTCAGACCACGGAATGATG and exon 3 targeting guide TTGTGGGTCACATCACTCCG, respectively.…”

“…To investigate the specificity of three CI targeting compounds, namely metformin, EVP 4593 and BAY 87-2243, we exploited unique cancer cell models lacking CI previously generated by knocking out the core subunit gene NDUFS3. In detail, we used ovarian carcinoma SKOV3 cells [45], colorectal cancer HCT116 [7] and murine melanoma B16-F10 [46] as representative of neoplasias in which metformin has shown contrasting data [23,30,[58][59][60]. These models have been previously characterized in terms of bioenergetics and CI stability [7,45,46].…”