Inducible expression of Bs2 R gene from Capsicum chacoense in sweet orange (Citrus sinensis L. Osbeck) confers enhanced resistance to citrus canker disease

Abstract

Transgenic expression of the pepper Bs2 gene confers resistance to Xanthomonas campestris pv. vesicatoria (Xcv) pathogenic strains which contain the avrBs2 avirulence gene in susceptible pepper and tomato varieties. The avrBs2 gene is highly conserved among members of the Xanthomonas genus, and the avrBs2 of Xcv shares 96% homology with the avrBs2 of Xanthomonas citri subsp. citri (Xcc), the causal agent of citrus canker disease. A previous study showed that the transient expression of pepper Bs2 in lemon leaves reduced canker formation and induced plant defence mechanisms. In this work, the effect of the stable expression of Bs2 gene on citrus canker resistance was evaluated in transgenic plants of Citrus sinensis cv. Pineapple. Interestingly, Agrobacterium-mediated transformation of epicotyls was unsuccessful when a constitutive promoter (2× CaMV 35S) was used in the plasmid construction, but seven transgenic lines were obtained with a genetic construction harbouring Bs2 under the control of a pathogen-inducible promoter, from glutathione S-transferase gene from potato. A reduction of disease symptoms of up to 70% was observed in transgenic lines expressing Bs2 with respect to non-transformed control plants. This reduction was directly dependent on the Xcc avrBs2 gene since no effect was observed when a mutant strain of Xcc with a disruption in avrBs2 gene was used for inoculations. Additionally, a canker symptom reduction was correlated with levels of the Bs2 expression in transgenic plants, as assessed by real-time qPCR, and accompanied by the production of reactive oxygen species. These results indicate that the pepper Bs2 resistance gene is also functional in a family other than the Solanaceae, and could be considered for canker control.

Mechanistic insights into host adaptation, virulence and epidemiology of the phytopathogenXanthomonas

“…For example, introduction of the pepper Bs2 or Arabidopsis ELONGATION FACTOR TU RECEPTOR (EFR) into tomato increases resistance to Xanthomonas bacterial spot in greenhouse and field trials (Horvath et al 2012;Kunwar et al 2018). Introduction of other resistance genes like pepper Bs2, rice Xa21 and N. benhtamiana FLAGELLIN SENSITIVE2 (FLS2) into citrus, maize Rxo1 into rice and rice Xa21 into banana inhibited Xanthomonas induced diseases in greenhouse and glasshouse conditions (Zhou et al 2010;Tripathi et al 2014;Hao et al 2015;Sendín et al 2017;Omar et al 2018). Durability of these transgenic plants in the field is yet to be determined.…”

Systematic Analysis and Functional Validation of Citrus XTH Genes Reveal the Role of Csxth04 in Citrus Bacterial Canker Resistance and Tolerance

“…Primers F-OEd (CGACACGCTTGTCTACTCCA) and R-OEd (TTAAATGTCACGGTCTCGTTTGCA) were used for overexpression plants; and F-RId (CTTCACCAGAATGCATTTAAATGTGTAA) and R-RId (GGTCTTACGGGATCCAAATACCTGCAAA) were used for silencing plants. The GUS activity in transgenic plants was detected using histochemical procedures (Sendín et al, 2017). Briefly, the leaf discs of transgenic citrus were infiltrated in X-GLUC solution (5-bromo-4-chloro-3-indolyl-beta-d-glucoronide) and incubated overnight at 37°C.…”

CsWAKL08, a pathogen-induced wall-associated receptor-like kinase in sweet orange, confers resistance to citrus bacterial canker via ROS control and JA signaling

“…Primers F OED (CGACACGCTTGTCTACTCCA) and R OED (TCACTGGTTTGAAATTAAAGGATCT) were used for the overexpression plants, while primers F RID (TGCAACTAAGTTCAGATTTAAATGTGTAA) and R RID (ATTCAAGTCGGATCCAAATACCTGCAA A) were used for the silencing plants. The GUS activity in the transgenic plants was assessed via a histochemical procedure 57 . qRT-PCR was performed to analyze the expression of CsWAKL08 in the transgenic plants.…”