Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of<i>Caenorhabditis elegans</i>males for molecular and biochemical analyses

Li, Qianyan; Kaur, Arshdeep; Mallory, Benjamin; Hariri, Sara; Engebrecht, JoAnne

doi:10.1093/g3journal/jkac085

Cited by 8 publications

(10 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This was insufficient material to see even with very good mNG nanobody to LOV-1::mNG. In the future, we are considering using 100% male producing strain (new strain using auxin inducible degron to select for males only) [ 37 ]. We would use nanotrap beads to immunoprecipitate wild-type and C2181S LOV-1::mNG from lysates of millions of males.…”

Section: Resultsmentioning

confidence: 99%

Tracking N- and C-termini of C. elegans polycystin-1 reveals their distinct targeting requirements and functions in cilia and extracellular vesicles

et al. 2022

View full text Add to dashboard Cite

The cilium acts as an antenna receiving and sending signals, the latter via extracellular vesicles (EVs). In C. elegans and mammals, the Autosomal Dominant Polycystic Kidney Disease (ADPKD) gene products polycystin-1 (PC1) and polycystin-2 (PC2) localize to both cilia and EVs, act in the same genetic pathway, and function in a sensory capacity, suggesting ancient conservation. However, the functions of the polycystins on cilia and EVs remain enigmatic. We used our C. elegans model and endogenously fluorescent-tagged LOV-1/polycystin-1 to study LOV-1 processing, trafficking, transport, EV biogenesis, and function in living animals. Super resolution, real time imaging reveals that LOV-1 is processed into N-terminal (NTM) and C-terminal (CTM) forms via a conserved GPCR proteolytic site (GPS). The LOV-1 NTM is secreted into the extracellular matrix and not localized to ciliary tip EVs. In contrast, LOV-1 CTM and PKD-2 are co-trafficked, co-transported, and co-localized in cilia and on environmentally released ciliary EVs. LOV-1 CTM requires PKD-2 for ciliary EV localization, while PKD-2 localizes to ciliary EVs independent of LOV-1. We find that LOV-1 but not PKD-2 is required for chemosensation of an ascaroside mating pheromone. These findings indicate that the polycystins LOV-1 and PKD-2 function together and independently and provide insight to how cargo is selected and packaged in ciliary EVs.

show abstract

Section: Resultsmentioning

confidence: 99%

Tracking N- and C-termini of C. elegans polycystin-1 reveals their distinct targeting requirements and functions in cilia and extracellular vesicles

et al. 2022

View full text Add to dashboard Cite

show abstract

“…The dosage compensation complex (DCC) plays an important role in balancing the expression of X-linked genes between males and females [ 115 ]. Recently, the knockdown of ten DCC members could reduce the elevated fat mass to normal levels in rict-1 mutants, suggesting that the DCC acted downstream of TORC2/rict-1 to negatively regulate the metabolism [ 116 ].…”

Section: Conserved Fat Metabolism Signaling Pathways In C E...mentioning

confidence: 99%

Application of Caenorhabditis elegans in Lipid Metabolism Research

Chen

et al. 2023

IJMS

View full text Add to dashboard Cite

Over the last decade, the development and prevalence of obesity have posed a serious public health risk, which has prompted studies on the regulation of adiposity. With the ease of genetic manipulation, the diversity of the methods for characterizing body fat levels, and the observability of feeding behavior, Caenorhabditis elegans (C. elegans) is considered an excellent model for exploring energy homeostasis and the regulation of the cellular fat storage. In addition, the homology with mammals in the genes related to the lipid metabolism allows many aspects of lipid modulation by the regulators of the central nervous system to be conserved in this ideal model organism. In recent years, as the complex network of genes that maintain an energy balance has been gradually expanded and refined, the regulatory mechanisms of lipid storage have become clearer. Furthermore, the development of methods and devices to assess the lipid levels has become a powerful tool for studies in lipid droplet biology and the regulation of the nematode lipid metabolism. Herein, based on the rapid progress of C. elegans lipid metabolism-related studies, this review outlined the lipid metabolic processes, the major signaling pathways of fat storage regulation, and the primary experimental methods to assess the lipid content in nematodes. Therefore, this model system holds great promise for facilitating the understanding, management, and therapies of human obesity and other metabolism-related diseases.

show abstract

“…cgcgtaattcgacaaaacgc, P2 Reverse: gcattaataactgcacccgc; P3 Forward: ggctcaacattagaaacaacgc, P3 Reverse: gatcaataatgcacgctctcag. ama-1 was used as control [95]…”

Section: Rt-pcrmentioning

confidence: 99%

“…P1 Forward: cgccacatttcaacagaaacc, P1 Reverse: gcttctttgctgtagtcgtg; P2 Forward: cgcgtaattcgacaaaacgc, P2 Reverse: gcattaataactgcacccgc; P3 Forward: ggctcaacattagaaacaacgc, P3 Reverse: gatcaataatgcacgctctcag. ama-1 was used as control [ 95 ]. (B) Immunoblot of whole worm extracts of BRD-1::GFP::3xFLAG and BRD-1 null ::GFP::3xFLAG with indicated molecular weight markers.…”

Section: Supporting Informationmentioning

confidence: 99%

Differential requirement for BRCA1-BARD1 E3 ubiquitin ligase activity in DNA damage repair and meiosis in the Caenorhabditis elegans germ line

Kaur

Okada

et al. 2023

PLoS Genet

Self Cite

View full text Add to dashboard Cite

The tumor suppressor BRCA1-BARD1 complex regulates many cellular processes; of critical importance to its tumor suppressor function is its role in genome integrity. Although RING E3 ubiquitin ligase activity is the only known enzymatic activity of the complex, the in vivo requirement for BRCA1-BARD1 E3 ubiquitin ligase activity has been controversial. Here we probe the role of BRCA1-BARD1 E3 ubiquitin ligase activity in vivo using C. elegans. Genetic, cell biological, and biochemical analyses of mutants defective for E3 ligase activity suggest there is both E3 ligase-dependent and independent functions of the complex in the context of DNA damage repair and meiosis. We show that E3 ligase activity is important for nuclear accumulation of the complex and specifically to concentrate at meiotic recombination sites but not at DNA damage sites in proliferating germ cells. While BRCA1 alone is capable of monoubiquitylation, BARD1 is required with BRCA1 to promote polyubiquitylation. We find that the requirement for E3 ligase activity and BARD1 in DNA damage signaling and repair can be partially alleviated by driving the nuclear accumulation and self-association of BRCA1. Our data suggest that in addition to E3 ligase activity, BRCA1 may serve a structural role for DNA damage signaling and repair while BARD1 plays an accessory role to enhance BRCA1 function.

show abstract

Inducible degradation of dosage compensation protein DPY-27 facilitates isolation ofCaenorhabditis elegansmales for molecular and biochemical analyses

Cited by 8 publications

References 54 publications

Tracking N- and C-termini of C. elegans polycystin-1 reveals their distinct targeting requirements and functions in cilia and extracellular vesicles

Tracking N- and C-termini of C. elegans polycystin-1 reveals their distinct targeting requirements and functions in cilia and extracellular vesicles

Application of Caenorhabditis elegans in Lipid Metabolism Research

Differential requirement for BRCA1-BARD1 E3 ubiquitin ligase activity in DNA damage repair and meiosis in the Caenorhabditis elegans germ line

Contact Info

Product

Resources

About