Indoxyl sulfate- and P-cresol-induced monocyte adhesion and migration is mediated by integrin-linked kinase-dependent podosome formation

Abstract

Cardiovascular disease is an important cause of death in patients with chronic kidney disease (CKD). Protein-bound uremic toxins, such as p-cresyl and indoxyl sulfate (IS), are poorly removed during hemodialysis, leading to vascular endothelial dysfunction and leukocyte extravasation. These processes can be related to dynamic adhesion structures called podosomes. Several studies have indicated the role of integrin-linked kinase (ILK) in the accumulation of integrin-associated proteins in podosomes. Here, we investigated the involvement of ILK and podosome formation in the adhesion and extravasation of monocytes under p-cresol (pc) and IS exposure. Incubation of THP-1 human monocyte cells with these toxins upregulated ILK kinase activity. Together, both toxins increased cell adhesion, podosome formation, extracellular matrix degradation, and migration of THP-1 cells, whereas ILK depletion with specific small interfering RNAs suppressed these processes. Interestingly, F-actin colocalized with cortactin in podosome cores, while ILK was colocalized in podosome rings under toxin stimulation. Podosome Wiskott-Aldrich syndrome protein (WASP)-interacting protein (WIP) and AKT protein depletion demonstrated that monocyte adhesion depends on podosome formation and that the ILK/AKT signaling pathway is involved in these processes. Ex vivo experiments showed that both toxins induced adhesion and podosome formation in leukocytes from wild-type mice, whereas these effects were not observed in leukocytes of conditional ILK-knockdown animals. In summary, under pc and IS stimulation, monocytes increase podosome formation and transmigratory capacity through an ILK/AKT signaling pathway-dependent mechanism, which could lead to vascular injury. Therefore, ILK could be a potential therapeutic target for the treatment of vascular damage associated with CKD.

Immune System Dysfunction and Inflammation in Hemodialysis Patients: Two Sides of the Same Coin

“…Monocytes are highly plastic cells able to modify their initial phenotype when facing environmental modifications, such as those in HD patients, with important consequences on their ability to interact with vascular structures, causing chronic inflammation [56].…”

Integrin-linked kinase mRNA expression in circulating mononuclear cells as a biomarker of kidney and vascular damage in experimental chronic kidney disease

“…CKD was induced in mice by feeding a diet containing 0.2% adenine (Sigma, St Louis, MO, USA) as previously described [ 22 ]. To decrease ILK expression, we used an inducible ILK knockdown mice (cKD-ILK) model, explained in prior publications [ 22 , 26 ]. Briefly, conditional inactivation of the ILK gene was accomplished by crossing C57Bl/6 mice homozygous for the floxed ILK allele (LOX mice) with homozygous mice carrying a tamoxifen-inducible CreER(T) recombinase gene, which express Cre under the control of the cytomegalovirus promoter (CRE mice).…”

“…Control animals were injected with the vehicle, a corn oil/ethanol (9:1) mixture. Three weeks after the injections, tail DNA was genotyped by PCR with primers allow to distinguish excised ILK gene (230 bp) or non-excised ILK (2100 bp): CCAGGTGGCAGAGGTAAGTA and CAAGGAATAAGGTGAGCTTCAGAA [ 22 , 26 ]. PCR DNA products were then analyzed by 1.5% agarose gel electrophoresis.…”

“…Non-excised ILK mRNA levels were measured in mice PBMCs, renal cortex (RC) and aortas by RT-qPCR with SYBR Green Master Mix to verify that ILK depletion had also occurred in these cells and tissues [ 22 , 26 ]. Primers GGGCTCTTGTGAGCTTCTGT and GAGTGGTCCCCTTCCAGAAT, designed to recognize the cDNA sequence between exons within floxed areas 6 and 7 [ 22 , 26 ] were used.…”

“…Regarding vascular physiologic and pathologic processes, in vivo and in vitro models showed that ILK plays a critical role in regulating vascular tone [ 23 , 24 ], and leucocyte adhesion to the endothelium [ 25 ]. Recently, our group has demonstrated that ILK is required for the formation of podosomes, structures that mediate cell adhesion and migration of monocytes across ECM-based barriers [ 26 ], which cause dysfunction and vascular damage in the context of uremia.…”