IND Submissions for Vaccines

Chandler, D. K. F.; McVittie, Loris D.; Novak, Jeanne A.

doi:10.1201/9781420048902.ch6

Cited by 4 publications

(4 citation statements)

References 4 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The classical model for dilution-to-extinction quantitative PCR is derived from Most-Probable Number (MPN) theory and assumes that organisms (or target nucleic acids) are randomly distributed in solution during dilution steps and that a single organism (or nucleic acid copy) gives rise to a positive signal. Upon closer inspection, the fundamental assumptions of quantitative MPN-PCR breakdown and competitive PCR techniques become difficult to validate (22). Thus, the qPCR technique employed here makes no assumptions regarding the PCR detection limit, and instead recognizes that the probability of detecting a given target will vary from day to day, from experiment to experiment, and under changing environmental or experimental conditions.…”

Section: Statisticsmentioning

confidence: 98%

“…Geobacter 16S rDNA was detected and enumerated with a dilution-to-extinction PCR approach (22) to estimate capture efficiency at low concentrations of target DNA (subfemtomolar). PCR primers S-␦401F-20 (5Ј AASCCTGACGCAGCRACGCC) and S-␦683aR-20 (5Ј TCTACGGATTTCACTCCTACAC) were synthesized by Keystone Labs (Camarillo, CA).…”

Section: Semiquantitative Pcr Detectionmentioning

confidence: 99%

See 1 more Smart Citation

Affinity Capture and Recovery of DNA at Femtomolar Concentrations with Peptide Nucleic Acid Probes

Chandler

Stults

Anderson

et al. 2000

Analytical Biochemistry

View full text Add to dashboard Cite

Section: Statisticsmentioning

confidence: 98%

Section: Semiquantitative Pcr Detectionmentioning

confidence: 99%

Affinity Capture and Recovery of DNA at Femtomolar Concentrations with Peptide Nucleic Acid Probes

Chandler

Stults

Anderson

et al. 2000

Analytical Biochemistry

View full text Add to dashboard Cite

“…Application of Real-Time TaqMan PCR Assays to WWTP Samples. In environmental samples, PCR techniques can be biased by the presence of inhibitory compounds that copurify with the DNA or low target concentrations in a high background of heterologous DNA (15,29). Inhibition effects by the environmental samples on the real-time PCR assays were tested using serial dilutions of genomic DNA extracted from MLSS.…”

Section: Development and Optimization Of Real-time Pcr Assaysmentioning

confidence: 99%

Real-Time PCR Quantification of Nitrifying Bacteria in a Municipal Wastewater Treatment Plant

Harms

Layton

Dionisi

et al. 2002

Environ. Sci. Technol.

474

255

View full text Add to dashboard Cite

Real-time PCR assays using TaqMan or Molecular Beacon probes were developed and optimized for the quantification of total bacteria, the nitrite-oxidizing bacteria Nitrospira, and Nitrosomonas oligotropha-like ammonia oxidizing bacteria (AOB) in mixed liquor suspended solids (MLSS) from a municipal wastewater treatment plant (WWTP) using a single-sludge nitrification process. The targets for the real-time PCR assays were the 16S rRNA genes (16S rDNA) for bacteria and Nitrospira spp. and the amoA gene for N. oligotropha. A previously reported assay for AOB 16S rDNA was also tested for its application to activated sludge. The Nitrospira 16S rDNA, AOB 16S rDNA, and N. oligotropha-like amoA assays were log-linear over 6 orders of magnitude and the bacterial 16S rDNA real-time PCR assay was log-linear over 4 orders of magnitude with DNA standards. When these real-time PCR assays were applied to DNA extracted from MLSS, dilution of the DNA extracts was necessary to prevent PCR inhibition. The optimal DNA dilution range was broad for the bacterial 16S rDNA (1000-fold) and Nitrospira 16S rDNA assays (2500-fold) but narrow for the AOB 16S rDNA assay (10-fold) and N. oligotropha-like amoA real-time PCR assay (5-fold). In twelve MLSS samples collected over one year, mean cell per L values were 4.3 +/- 2.0 x 10(11) for bacteria, 3.7 +/- 3.2 x 10(10) for Nitrospira, 1.2 +/- 0.9 x 10(10) for all AOB, and 7.5 +/- 6.0 x 10(9) for N. oligotropha-like AOB. The percent of the nitrifying population was 1.7% N. oligotropha-like AOB based on the N. oligotropha amoA assay, 2.9% total AOB based on the AOB 16S rDNA assay, and 8.6% nitrite-oxidizing bacteria based on the Nitrospira 16S rDNA assay. Ammonia-oxidizing bacteria in the wastewater treatment plant were estimated to oxidize 7.7 +/- 6.8 fmol/hr/cell based on the AOB 16S rDNA assay and 12.4 +/- 7.3 fmol/hr/cell based on the N. oligotropha amoA assay.

show abstract

“…Unfortunately, all three of these factors will vary between each sample, and if the analysis fails to consider these factors, the results will be very difficult to assess in the context of risk to human health. Some interpretative aspects of PCR assays could be improved by using quantitative methods such as MPN-PCR (5) or Taqman assays (6). Nevertheless, interpreting results from quantitative methods still requires an explicit assessment of the effects of sample volume and template recovery.…”

Section: Introductionmentioning

confidence: 99%

PCR Detection of Specific Pathogens in Water: A Risk-Based Analysis

Loge

Thompson

Call

2002

Environ. Sci. Technol.

View full text Add to dashboard Cite

The relative concentration of pathogens in water samples collected from storm drains and adjacent surfaces was evaluated using established PCR-based protocols. Out of the 58 samples collected from 21 different storm drains, 22% were PCR positive for Escherichia coli ETEC, Salmonella, or adenovirus. The risk of swimming related illnesses associated with detection of E. coli ETEC and Salmonella ranged from 0.39 to 30:100 000 and 0.3-25:1000, respectively. The detection limit corresponding to a negative-PCR result was evaluated in reference to water quality standards developed using a risk-based approach that integrates human dose-response data with acceptable levels of risk promulgated by the U.S. EPA for recreational contact. The percent of samples with an acceptable detection limit ranged from 0% for Giardia lamblia and Shigella to 100% for E. coli ETEC. The principal factor influencing the detection limit of G. lamblia and Shigella was sample volume. The principal factor influencing the detection limit of the remaining bacteria and protozoa, including E. coli O157:H7, Salmonella, and Cryptosporidium parvum, was the presence of inhibitory compounds in the purified nucleic acid extracts. Both recovery and inhibition adversely impacted the detection limit of viruses. Ambient water quality standards based on the occurrence of specific pathogens enumerated with PCR-based assays could serve as a method of evaluating the biological quality of water but only after significant improvements in filtration and purification protocols. The risk-based methodology developed in this study can be used to evaluate future improvements in filtration and purification protocols.

show abstract

IND Submissions for Vaccines

Cited by 4 publications

References 4 publications

Affinity Capture and Recovery of DNA at Femtomolar Concentrations with Peptide Nucleic Acid Probes

Affinity Capture and Recovery of DNA at Femtomolar Concentrations with Peptide Nucleic Acid Probes

Real-Time PCR Quantification of Nitrifying Bacteria in a Municipal Wastewater Treatment Plant

PCR Detection of Specific Pathogens in Water: A Risk-Based Analysis

Contact Info

Product

Resources

About