Increased p70s6k phosphorylation during intake of a protein–carbohydrate drink following resistance exercise in the fasted state

Abstract

The present study aimed at comparing the responses of myogenic regulatory factors and signaling pathways involved in muscle protein synthesis after a resistance training session performed in either the fasted or fed state. According to a randomized crossover study design, six young male subjects participated in two experimental sessions separated by 3 weeks. In each session, they performed a standardized resistance training. After the sessions, they received during a 4-h recovery period 6 ml/kg b.w. h of a solution containing carbohydrates (50 g/l), protein hydrolysate (33 g/l), and leucine (16.6 g/l). On one occasion, the resistance exercise session was performed after the intake of a carbohydrate-rich breakfast (B), whereas in the other session they remained fasted (F). Needle biopsies from m. vastus lateralis were obtained before (Rest), and 1 h (+1h) and 4 h (+4h) after exercise. Myogenin, MRF4, and MyoD1 mRNA contents were determined by RT-PCR. Phosphorylation of PKB (protein kinase B), GSK3, p70(s6k) (p70 ribosomal S6 kinase), eIF2B, eEF2 (eukaryotic elongation factor 2), ERK1/2, and p38 was measured via western blotting. Compared with F, the pre-exercise phosphorylation states of PKB and p70(s6k) were higher in B, whereas those of eIF2B and eEF2 were lower. During recovery, the phosphorylation state of p70(s6k) was lower in B than in F (p = 0.02). There were no differences in basal mRNA contents between B and F. However, compared with F at +1h, MyoD1 and MRF4 mRNA contents were lower in B (p< 0.05). Our results indicate that prior fasting may stimulate the intramyocellular anabolic response to ingestion of a carbohydrate/protein/leucine mixture following a heavy resistance training session.

Protein supplementation does not alter intramuscular anabolic signaling or endocrine response after resistance exercise in trained men

“…The results of this present study suggest that the regulation of signaling proteins within mTORC1, including Akt, mTOR, p70S6k, and RPS6, was not augmented by ingestion of the protein supplement. This is in contrast to other investigations that have demonstrated superior intramuscular anabolic signaling when proteinis ingested following resistance exercise in untrained men [28][29][30][31]73]. Only a limited number of studies have investigated the influence of protein supplementation in a trained population [70,74].Areta and colleagues [74] reported elevationsin p70S6k phosphorylation in response to three different feeding patterns of 80 g protein following resistance exercise in trained men, whileGloveret al [70]reported elevations in the phosphorylation of p70S6k and RPS6 in response to three mixed meal drinks (10 g protein; 41 g carbohydrate; 4 g fat) provided every 1.5 hours into recovery from resistance exercise in trained men.…”

“…Proteinsupplementation combined with resistance exercise appears to further augment intramuscular anabolic signaling [28][29][30][31][32] and muscle protein synthesis [33,34] in untrained men. Muscle protein synthesis appears to increase in a dosedependent mannerwith protein intakes up to ~20 grams of high-quality protein (~10 grams essential amino acids)in participants with recreational weight-lifting experience [35,36].…”

Roles of Glycogen Synthase Kinase 3 in Alzheimer’s Disease

“…GSK-3 also phosphorylates several transcription factors which include cyclic AMP response element binding protein, c-Jun, c-Myc, c-Myb, heat shock transcription factor HSF-1 and the translation initiation factors eIF2 and eIF2B [53]. Phosphorylation of transcription factors by GSK-3 causes ubiquitination, nuclear exit, or decreases in the DNA binding, leading to decrease in nuclear transcription [54,55]. In neuronal cells, GSK-3 phosphorylate a number of MAPs, such as MAP2C, MAP1B and tau [56].…”

The unfolded protein response in human skeletal muscle is not involved in the onset of glucose tolerance impairment induced by a fat-rich diet

“…Fiber type-specific IMCL content was expressed as arbitrary units (A.U.). qPCR analysis RNA extraction and reverse transcription have been described previously (Deldicque et al 2010b). qPCR (quantitative polymerase chain reaction) primers were designed for human spliced XBP1 (Fwd, CCGCAGCA GGTGCAGG; Rev, GAGTCAATACCGCCAGAATCCA; NM_005080), CHOP (Fwd, CTGGCTTGGCTGACTGAG GAG; Rev, CGGGCTGGGGAATGACC; NM_004083), ATF4 (Fwd, CCAACAACAGCAAGGAGGATG; Rev, GTCATCCAACGTGGTCAGAAGG; NM_001675), RPL 19 (Fwd, CGCTGTGGCAAGAAGAAGGTC; Rev, GG AATGGACCGTCACAGGC; NM_000981) and beta-2-microglobulin (Fwd, ATGAGTATGCCTGCCGTGT GA; Rev, GGCATCTTCAAACCTCCATG; NM_004048).…”